rs1553368576
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PS3PM1PM4PP3PP5
The NM_000251.3(MSH2):c.1818_1877delCAGCTTTGCTCACGTGTCAAATGGAGCACCTGTTCCATATGTACGACCAGCCATTTTGGA(p.Ser607_Glu626del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). ClinVar reports functional evidence for this variant: "SCV002713076: Based on internal structural analysis using published crystal structures, S607_E626del removes a portion of MSH2 linking the MutS III and V domains, a region enriched in pathogenic variants (Warren JJ et al. Mol Cell, 2007 May" and additional evidence is available in ClinVar. Synonymous variant affecting the same amino acid position (i.e. V606V) has been classified as Benign. The gene MSH2 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_000251.3 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- Lynch syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet, G2P
- Lynch syndrome 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- Muir-Torre syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet, G2P
- mismatch repair cancer syndrome 1Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
- mismatch repair cancer syndrome 2Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
- ovarian cancerInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- malignant pancreatic neoplasmInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- prostate cancerInheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
- rhabdomyosarcomaInheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
- breast cancerInheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics
- hereditary breast carcinomaInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000251.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MSH2 | MANE Select | c.1818_1877delCAGCTTTGCTCACGTGTCAAATGGAGCACCTGTTCCATATGTACGACCAGCCATTTTGGA | p.Ser607_Glu626del | disruptive_inframe_deletion | Exon 12 of 16 | NP_000242.1 | P43246-1 | ||
| MSH2 | c.1818_1877delCAGCTTTGCTCACGTGTCAAATGGAGCACCTGTTCCATATGTACGACCAGCCATTTTGGA | p.Ser607_Glu626del | disruptive_inframe_deletion | Exon 12 of 18 | NP_001393603.1 | ||||
| MSH2 | c.1818_1877delCAGCTTTGCTCACGTGTCAAATGGAGCACCTGTTCCATATGTACGACCAGCCATTTTGGA | p.Ser607_Glu626del | disruptive_inframe_deletion | Exon 12 of 18 | NP_001393560.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MSH2 | TSL:1 MANE Select | c.1818_1877delCAGCTTTGCTCACGTGTCAAATGGAGCACCTGTTCCATATGTACGACCAGCCATTTTGGA | p.Ser607_Glu626del | disruptive_inframe_deletion | Exon 12 of 16 | ENSP00000233146.2 | P43246-1 | ||
| MSH2 | TSL:1 | c.1818_1877delCAGCTTTGCTCACGTGTCAAATGGAGCACCTGTTCCATATGTACGACCAGCCATTTTGGA | p.Ser607_Glu626del | disruptive_inframe_deletion | Exon 12 of 16 | ENSP00000384199.1 | E9PHA6 | ||
| MSH2 | c.1869_1928delCAGCTTTGCTCACGTGTCAAATGGAGCACCTGTTCCATATGTACGACCAGCCATTTTGGA | p.Ser624_Glu643del | disruptive_inframe_deletion | Exon 13 of 17 | ENSP00000588166.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at