chr2-47806652-G-GTAACTAACTAACTATAATGGAATTA
Variant summary
Our verdict is Uncertain significance. Variant got 0 ACMG points: 2P and 2B. PM2BP6_Moderate
The NM_000179.3(MSH6):c.4001+11_4001+35dupAACTATAATGGAATTATAACTAACT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely benign (★).
Frequency
Genomes: not found (cov: 32)
Consequence
MSH6
NM_000179.3 intron
NM_000179.3 intron
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 0.0550
Genes affected
MSH6 (HGNC:7329): (mutS homolog 6) This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]
FBXO11 (HGNC:13590): (F-box protein 11) This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Uncertain_significance. Variant got 0 ACMG points.
PM2
Very rare variant in population databases, with high coverage;
BP6
Variant 2-47806652-G-GTAACTAACTAACTATAATGGAATTA is Benign according to our data. Variant chr2-47806652-G-GTAACTAACTAACTATAATGGAATTA is described in ClinVar as [Likely_benign]. Clinvar id is 1536230.Status of the report is criteria_provided_single_submitter, 1 stars.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
GnomAD4 exome Cov.: 34
GnomAD4 exome
Cov.:
34
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Likely benign
Submissions summary: Benign:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Hereditary nonpolyposis colorectal neoplasms Benign:1
Jul 27, 2024
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Likely benign
Review Status: criteria provided, single submitter
Collection Method: clinical testing
- -
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
Publications
No publications associated with this variant yet.