rs878853743
Variant summary
Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BP6_Very_Strong
The NM_000179.3(MSH6):c.4001+11_4001+35delAACTATAATGGAATTATAACTAACT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000168 in 1,607,080 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★). The gene MSH6 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_000179.3 intron
Scores
Clinical Significance
Conservation
Publications
- intellectual developmental disorder with dysmorphic facies and behavioral abnormalitiesInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000179.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MSH6 | MANE Select | c.4001+11_4001+35delAACTATAATGGAATTATAACTAACT | intron | N/A | NP_000170.1 | P52701-1 | |||
| MSH6 | c.4097+11_4097+35delAACTATAATGGAATTATAACTAACT | intron | N/A | NP_001393724.1 | |||||
| MSH6 | c.4007+11_4007+35delAACTATAATGGAATTATAACTAACT | intron | N/A | NP_001393742.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MSH6 | TSL:1 MANE Select | c.4001+11_4001+35delAACTATAATGGAATTATAACTAACT | intron | N/A | ENSP00000234420.5 | P52701-1 | |||
| MSH6 | TSL:1 | n.*3348+11_*3348+35delAACTATAATGGAATTATAACTAACT | intron | N/A | ENSP00000405294.1 | F8WAX8 | |||
| MSH6 | c.4028+11_4028+35delAACTATAATGGAATTATAACTAACT | intron | N/A | ENSP00000606570.1 |
Frequencies
GnomAD3 genomes AF: 0.00000658 AC: 1AN: 151882Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.0000205 AC: 5AN: 244224 AF XY: 0.0000302 show subpopulations
GnomAD4 exome AF: 0.0000179 AC: 26AN: 1455198Hom.: 0 AF XY: 0.0000221 AC XY: 16AN XY: 724206 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.00000658 AC: 1AN: 151882Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0AN XY: 74180 show subpopulations
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.