chr21-33432274-AAAGTAACATCTTTAGAGTCGGGCATTT-A

Position:

• chr21-33432274-AAAGTAACATCTTTAGAGTCGGGCATTT-A

Variant summary

Our verdict is Likely pathogenic. Variant got 7 ACMG points: 7P and 0B. PM1 PM2 PM4 PP5

The NM_005534.4(IFNGR2):​c.663_689delTAACATCTTTAGAGTCGGGCATTTAAG​(p.Asn222_Ser230del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 33)
• Consequence: IFNGR2 NM_005534.4 disruptive_inframe_deletion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 0.613

Genes affected

IFNGR2 (HGNC:5440): (interferon gamma receptor 2) This gene (IFNGR2) encodes the non-ligand-binding beta chain of the gamma interferon receptor. Human interferon-gamma receptor is a heterodimer of IFNGR1 and IFNGR2. Defects in IFNGR2 are a cause of mendelian susceptibility to mycobacterial disease (MSMD), also known as familial disseminated atypical mycobacterial infection. MSMD is a genetically heterogeneous disease with autosomal recessive, autosomal dominant or X-linked inheritance. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_pathogenic. Variant got 7 ACMG points.

• PM1: In a domain Fibronectin type-III 2 (size 98) in uniprot entity INGR2_HUMAN there are 4 pathogenic changes around while only 1 benign (80%) in NM_005534.4
• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_005534.4.
• PP5: Variant 21-33432274-AAAGTAACATCTTTAGAGTCGGGCATTT-A is Pathogenic according to our data. Variant chr21-33432274-AAAGTAACATCTTTAGAGTCGGGCATTT-A is described in ClinVar as [Pathogenic]. Clinvar id is 14728.Status of the report is no_assertion_criteria_provided, 0 stars. Variant chr21-33432274-AAAGTAACATCTTTAGAGTCGGGCATTT-A is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
IFNGR2	NM_005534.4	c.663_689delTAACATCTTTAGAGTCGGGCATTTAAG	p.Asn222_Ser230del	disruptive_inframe_deletion	5/7	ENST00000290219.11	NP_005525.2
IFNGR2	NM_001329128.2	c.720_746delTAACATCTTTAGAGTCGGGCATTTAAG	p.Asn241_Ser249del	disruptive_inframe_deletion	6/8		NP_001316057.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
IFNGR2	ENST00000290219.11	c.663_689delTAACATCTTTAGAGTCGGGCATTTAAG	p.Asn222_Ser230del	disruptive_inframe_deletion	5/7	1	NM_005534.4	ENSP00000290219.5

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Immunodeficiency 28 Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

Jul 01, 2005

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs587776823; hg19: chr21-34804581;