rs587776823

Variant names:

• chr21-33432274-AAAGTAACATCTTTAGAGTCGGGCATTT-A
• rs587776823
• NM_005534.4:c.663_689delTAACATCTTTAGAGTCGGGCATTTAAG

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4 PP5

The NM_005534.4(IFNGR2):​c.663_689delTAACATCTTTAGAGTCGGGCATTTAAG​(p.Asn222_Ser230del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 33)
• Consequence: IFNGR2 NM_005534.4 disruptive_inframe_deletion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 0.613
• Publications: 0 publications found

Genes affected

IFNGR2 (HGNC:5440): (interferon gamma receptor 2) This gene (IFNGR2) encodes the non-ligand-binding beta chain of the gamma interferon receptor. Human interferon-gamma receptor is a heterodimer of IFNGR1 and IFNGR2. Defects in IFNGR2 are a cause of mendelian susceptibility to mycobacterial disease (MSMD), also known as familial disseminated atypical mycobacterial infection. MSMD is a genetically heterogeneous disease with autosomal recessive, autosomal dominant or X-linked inheritance. [provided by RefSeq, Jul 2008]

TMEM50B (HGNC:1280): (transmembrane protein 50B) Predicted to be involved in late endosome to vacuole transport via multivesicular body sorting pathway. Located in endoplasmic reticulum. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_005534.4.
• PP5: Variant 21-33432274-AAAGTAACATCTTTAGAGTCGGGCATTT-A is Pathogenic according to our data. Variant chr21-33432274-AAAGTAACATCTTTAGAGTCGGGCATTT-A is described in ClinVar as Pathogenic. ClinVar VariationId is 14728.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
IFNGR2	NM_005534.4	c.663_689delTAACATCTTTAGAGTCGGGCATTTAAG	p.Asn222_Ser230del	disruptive_inframe_deletion	Exon 5 of 7	ENST00000290219.11	NP_005525.2
IFNGR2	NM_001329128.2	c.720_746delTAACATCTTTAGAGTCGGGCATTTAAG	p.Asn241_Ser249del	disruptive_inframe_deletion	Exon 6 of 8		NP_001316057.1
TMEM50B	NR_040016.2	n.*185_*211delAAATGCCCGACTCTAAAGATGTTACTT		downstream_gene_variant
TMEM50B	XM_011529746.3	c.*2732_*2758delAAATGCCCGACTCTAAAGATGTTACTT		downstream_gene_variant			XP_011528048.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
IFNGR2	ENST00000290219.11	c.663_689delTAACATCTTTAGAGTCGGGCATTTAAG	p.Asn222_Ser230del	disruptive_inframe_deletion	Exon 5 of 7	1	NM_005534.4	ENSP00000290219.5

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Immunodeficiency 28 Pathogenic:1

Jul 01, 2005

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.61
Mutation Taster		=18/182	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs587776823; hg19: chr21-34804581;