chr21-44286024-GCTACGCCGGCTTCTGAGGCTGCACCGCACGGAGATCGCGGTGGCCGTGGACAGCGCCTTCCCACTGCTGCACGCGCTGGCTGACCACGACGTGGTC-G

Position:

• chr21-44286024-GCTACGCCGGCTTCTGAGGCTGCACCGCACGGAGATCGCGGTGGCCGTGGACAGCGCCTTCCCACTGCTGCACGCGCTGGCTGACCACGACGTGGTC-G

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PM1 PM2 PM4 PP5_Moderate

The NM_000383.4(AIRE):​c.20_115del​(p.Leu7_Val38del) variant causes a inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. L7L) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: AIRE NM_000383.4 inframe_deletion
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 2.28

Genes affected

AIRE (HGNC:360): (autoimmune regulator) This gene encodes a transcriptional regulator that forms nuclear bodies and interacts with the transcriptional coactivator CREB binding protein. The encoded protein plays an important role in immunity by regulating the expression of autoantigens and negative selection of autoreactive T-cells in the thymus. Mutations in this gene cause the rare autosomal-recessive systemic autoimmune disease termed autoimmune polyendocrinopathy with candidiasis and ectodermal dystrophy (APECED). [provided by RefSeq, Jun 2012]

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PM1: In a hotspot region, there are 5 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 4 uncertain in NM_000383.4
• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000383.4.
• PP5: Variant 21-44286024-GCTACGCCGGCTTCTGAGGCTGCACCGCACGGAGATCGCGGTGGCCGTGGACAGCGCCTTCCCACTGCTGCACGCGCTGGCTGACCACGACGTGGTC-G is Pathogenic according to our data. Variant chr21-44286024-GCTACGCCGGCTTCTGAGGCTGCACCGCACGGAGATCGCGGTGGCCGTGGACAGCGCCTTCCCACTGCTGCACGCGCTGGCTGACCACGACGTGGTC-G is described in ClinVar as [Pathogenic]. Clinvar id is 2580370.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
AIRE	NM_000383.4	c.20_115del	p.Leu7_Val38del	inframe_deletion	1/14	ENST00000291582.6

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
AIRE	ENST00000291582.6	c.20_115del	p.Leu7_Val38del	inframe_deletion	1/14	1	NM_000383.4	P1
AIRE	ENST00000527919.5	n.181_276del		non_coding_transcript_exon_variant	1/14	2
AIRE	ENST00000530812.5	n.189_284del		non_coding_transcript_exon_variant	1/12	2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Polyglandular autoimmune syndrome, type 1 Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

National Institute of Allergy and Infectious Diseases - Centralized Sequencing Program, National Institutes of Health

Sep 14, 2023

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr21-45705907;