chr21-44331921-TTGGGGCCGCCGTGGCCTGTGCCCTCTCTCTC-T

Variant names:

• chr21-44331921-TTGGGGCCGCCGTGGCCTGTGCCCTCTCTCTC-T
• rs746633371
• NM_004928.3:c.436_466delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_001271441.2(CFAP410):​c.436_466delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA​(p.Glu146SerfsTer6) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000342 in 1,461,090 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000034 (0 hom.)
• Consequence: CFAP410 NM_001271441.2 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 1.53
• Publications: 2 publications found

Genes affected

CFAP410 (HGNC:1260): (cilia and flagella associated protein 410) Four alternatively spliced transcript variants encoding four different isoforms have been found for this nuclear gene. All isoforms contain leucine-rich repeats. Three of these isoforms are mitochondrial proteins and one of them lacks the target peptide, so is not located in mitochondrion. This gene is down-regulated in Down syndrome (DS) brain, which may represent mitochondrial dysfunction in DS patients. [provided by RefSeq, Sep 2012]

CFAP410 Gene-Disease associations (from GenCC):

• axial spondylometaphyseal dysplasia

  Inheritance: AR Classification: DEFINITIVE Submitted by: G2P
• amyotrophic lateral sclerosis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• cone-rod dystrophy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000184441 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 21-44331921-TTGGGGCCGCCGTGGCCTGTGCCCTCTCTCTC-T is Pathogenic according to our data. Variant chr21-44331921-TTGGGGCCGCCGTGGCCTGTGCCCTCTCTCTC-T is described in ClinVar as Pathogenic. ClinVar VariationId is 428576.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001271441.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CFAP410	NM_004928.3	MANE Select	c.436_466delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA	p.Glu146SerfsTer6	frameshift	Exon 5 of 7	NP_004919.1
	CFAP410	NM_001271441.2		c.436_466delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA	p.Glu146SerfsTer6	frameshift	Exon 5 of 7	NP_001258370.1
	CFAP410	NM_001271440.2		c.436_466delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA	p.Glu146SerfsTer6	frameshift	Exon 5 of 7	NP_001258369.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CFAP410	ENST00000339818.9	TSL:1 MANE Select	c.436_466delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA	p.Glu146SerfsTer6	frameshift	Exon 5 of 7	ENSP00000344566.4
	CFAP410	ENST00000397956.7	TSL:1	c.436_466delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA	p.Glu146SerfsTer6	frameshift	Exon 5 of 7	ENSP00000381047.3
	CFAP410	ENST00000325223.7	TSL:1	c.436_466delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA	p.Glu146SerfsTer6	frameshift	Exon 5 of 7	ENSP00000317302.7

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD2 exomes AF: 0.00000803 AC: 2 AN: 249120 AF XY: 0.0000148

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000178

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000342 AC: 5 AN: 1461090 Hom.: 0 AF XY: 0.00000275 AC XY: 2 AN XY: 726848

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33462

American (AMR) AF: 0.00 AC: 0 AN: 44660

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26126

East Asian (EAS) AF: 0.00 AC: 0 AN: 39668

South Asian (SAS) AF: 0.00 AC: 0 AN: 86184

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53044

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5748

European-Non Finnish (NFE) AF: 0.00000450 AC: 5 AN: 1111816

Other (OTH) AF: 0.00 AC: 0 AN: 60382

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000000359436), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 33

Alfa AF: 0.0000936 Hom.: 0

Bravo AF: 0.00000378

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	not provided (1)
1	-	-	Retinal dystrophy with or without macular staphyloma (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.5
Mutation Taster		=8/192	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs746633371; hg19: chr21-45751804;