rs746633371

Variant names:

• chr21-44331921-TTGGGGCCGCCGTGGCCTGTGCCCTCTCTCTC-T
• rs746633371
• NM_004928.3:c.436_466delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_004928.3(CFAP410):​c.436_466delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA​(p.Glu146SerfsTer6) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000342 in 1,461,090 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000034 (0 hom.)
• Consequence: CFAP410 NM_004928.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 1.53

Genes affected

CFAP410 (HGNC:1260): (cilia and flagella associated protein 410) Four alternatively spliced transcript variants encoding four different isoforms have been found for this nuclear gene. All isoforms contain leucine-rich repeats. Three of these isoforms are mitochondrial proteins and one of them lacks the target peptide, so is not located in mitochondrion. This gene is down-regulated in Down syndrome (DS) brain, which may represent mitochondrial dysfunction in DS patients. [provided by RefSeq, Sep 2012]

ENSG00000184441 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 21-44331921-TTGGGGCCGCCGTGGCCTGTGCCCTCTCTCTC-T is Pathogenic according to our data. Variant chr21-44331921-TTGGGGCCGCCGTGGCCTGTGCCCTCTCTCTC-T is described in ClinVar as [Pathogenic]. Clinvar id is 428576.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr21-44331921-TTGGGGCCGCCGTGGCCTGTGCCCTCTCTCTC-T is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CFAP410	NM_004928.3	c.436_466delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA	p.Glu146SerfsTer6	frameshift_variant	Exon 5 of 7	ENST00000339818.9	NP_004919.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CFAP410	ENST00000339818.9	c.436_466delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA	p.Glu146SerfsTer6	frameshift_variant	Exon 5 of 7	1	NM_004928.3	ENSP00000344566.4

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD3 exomes AF: 0.00000803 AC: 2 AN: 249120 Hom.: 0 AF XY: 0.0000148 AC XY: 2 AN XY: 135094

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000178

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000342 AC: 5 AN: 1461090 Hom.: 0 AF XY: 0.00000275 AC XY: 2 AN XY: 726848

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000450

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 33

Alfa AF: 0.0000936 Hom.: 0

Bravo AF: 0.00000378

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

Oct 29, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Glu146Serfs*6) in the CFAP410 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in CFAP410 are known to be pathogenic (PMID: 23105016, 26167768). This variant is present in population databases (rs746633371, gnomAD 0.002%). This premature translational stop signal has been observed in individuals with inherited retinal dystrophy (PMID: 26294103). ClinVar contains an entry for this variant (Variation ID: 428576). For these reasons, this variant has been classified as Pathogenic. -

Retinal dystrophy with or without macular staphyloma Pathogenic:1

Jul 17, 2018

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs746633371; hg19: chr21-45751804;