chr21-46002718-TGGGGCCACCCGGGCAGTCCCAGATCTGCGTAGGTGCGCGC-T

Variant names:

• chr21-46002718-TGGGGCCACCCGGGCAGTCCCAGATCTGCGTAGGTGCGCGC-T
• rs1064795349
• NM_001848.3:c.2434+15_2434+54delACCCGGGCAGTCCCAGATCTGCGTAGGTGCGCGCGGGGCC

Variant summary

Our verdict is Benign. Variant got -16 ACMG points: 0P and 16B. BP6_Very_Strong BS1 BS2

The NM_001848.3(COL6A1):​c.2434+15_2434+54delACCCGGGCAGTCCCAGATCTGCGTAGGTGCGCGCGGGGCC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00729 in 150,724 control chromosomes in the GnomAD database, including 8 homozygotes. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0073 (8 hom., cov: 35)
  • Exomes 𝑓: 0.0010 (25 hom.)
  • Failed GnomAD Quality Control
• Consequence: COL6A1 NM_001848.3 intron
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:3
• Conservation: PhyloP100: 0.504

Genes affected

COL6A1 (HGNC:2211): (collagen type VI alpha 1 chain) The collagens are a superfamily of proteins that play a role in maintaining the integrity of various tissues. Collagens are extracellular matrix proteins and have a triple-helical domain as their common structural element. Collagen VI is a major structural component of microfibrils. The basic structural unit of collagen VI is a heterotrimer of the alpha1(VI), alpha2(VI), and alpha3(VI) chains. The alpha2(VI) and alpha3(VI) chains are encoded by the COL6A2 and COL6A3 genes, respectively. The protein encoded by this gene is the alpha 1 subunit of type VI collagen (alpha1(VI) chain). Mutations in the genes that code for the collagen VI subunits result in the autosomal dominant disorder, Bethlem myopathy. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Benign. Variant got -16 ACMG points.

• BP6: Variant 21-46002718-TGGGGCCACCCGGGCAGTCCCAGATCTGCGTAGGTGCGCGC-T is Benign according to our data. Variant chr21-46002718-TGGGGCCACCCGGGCAGTCCCAGATCTGCGTAGGTGCGCGC-T is described in ClinVar as [Likely_benign]. Clinvar id is 421765.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr21-46002718-TGGGGCCACCCGGGCAGTCCCAGATCTGCGTAGGTGCGCGC-T is described in Lovd as [Likely_benign].
• BS1: Variant frequency is greater than expected in population afr. gnomad4 allele frequency = 0.00729 (1099/150724) while in subpopulation AFR AF= 0.0228 (928/40708). AF 95% confidence interval is 0.0216. There are 8 homozygotes in gnomad4. There are 512 alleles in male gnomad4 subpopulation. Median coverage is 35. This position pass quality control queck.
• BS2: High Homozygotes in GnomAd4 at 8 AD,AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
COL6A1	NM_001848.3	c.2434+15_2434+54delACCCGGGCAGTCCCAGATCTGCGTAGGTGCGCGCGGGGCC		intron_variant	Intron 33 of 34	ENST00000361866.8	NP_001839.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
COL6A1	ENST00000361866.8	c.2434+9_2434+48delGGGGCCACCCGGGCAGTCCCAGATCTGCGTAGGTGCGCGC		intron_variant	Intron 33 of 34	1	NM_001848.3	ENSP00000355180.3

Frequencies

GnomAD3 genomes AF: 0.00729 AC: 1098 AN: 150614 Hom.: 8 Cov.: 35

Gnomad AFR AF: 0.0228

Gnomad AMI AF: 0.00111

Gnomad AMR AF: 0.00224

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000391

Gnomad SAS AF: 0.000837

Gnomad FIN AF: 0.000667

Gnomad MID AF: 0.00633

Gnomad NFE AF: 0.00162

Gnomad OTH AF: 0.00579

GnomAD3 exomes AF: 0.000741 AC: 182 AN: 245736 Hom.: 5 AF XY: 0.000690 AC XY: 92 AN XY: 133396

Gnomad AFR exome AF: 0.00791

Gnomad AMR exome AF: 0.000493

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.0000547

Gnomad SAS exome AF: 0.000164

Gnomad FIN exome AF: 0.000142

Gnomad NFE exome AF: 0.000265

Gnomad OTH exome AF: 0.000332

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00104 AC: 1508 AN: 1456832 Hom.: 25 AF XY: 0.000992 AC XY: 719 AN XY: 724520

Gnomad4 AFR exome AF: 0.0180

Gnomad4 AMR exome AF: 0.00135

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.000152

Gnomad4 SAS exome AF: 0.000210

Gnomad4 FIN exome AF: 0.000498

Gnomad4 NFE exome AF: 0.000635

Gnomad4 OTH exome AF: 0.00155

GnomAD4 genome AF: 0.00729 AC: 1099 AN: 150724 Hom.: 8 Cov.: 35 AF XY: 0.00695 AC XY: 512 AN XY: 73690

Gnomad4 AFR AF: 0.0228

Gnomad4 AMR AF: 0.00224

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000392

Gnomad4 SAS AF: 0.000838

Gnomad4 FIN AF: 0.000667

Gnomad4 NFE AF: 0.00162

Gnomad4 OTH AF: 0.00573

Alfa AF: 0.000223 Hom.: 0

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Benign:1

Aug 10, 2016

GeneDx

Significance: Likely benign

Review Status: flagged submission

Collection Method: clinical testing

This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at a poorly conserved position in the protein, it is predicted to be benign by multiple in silico algorithms, and/or has population frequency not consistent with disease. -

Bethlem myopathy 1A Benign:1

Jan 30, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not provided Benign:1

Sep 02, 2019

GeneDx

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1064795349; hg19: chr21-47422632;