rs1064795349

Variant names:

• chr21-46002718-TGGGGCCACCCGGGCAGTCCCAGATCTGCGTAGGTGCGCGC-T
• rs1064795349
• NM_001848.3:c.2434+15_2434+54delACCCGGGCAGTCCCAGATCTGCGTAGGTGCGCGCGGGGCC

Variant summary

Our verdict is Benign. The variant received -12 ACMG points: 0P and 12B. BP6_Very_Strong BS2

The NM_001848.3(COL6A1):​c.2434+15_2434+54delACCCGGGCAGTCCCAGATCTGCGTAGGTGCGCGCGGGGCC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00729 in 150,724 control chromosomes in the GnomAD database, including 8 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0073 (8 hom., cov: 35)
  • Exomes 𝑓: 0.0010 (25 hom.)
  • Failed GnomAD Quality Control
• Consequence: COL6A1 NM_001848.3 intron
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:3
• Conservation: PhyloP100: 0.504
• Publications: 0 publications found

Genes affected

COL6A1 (HGNC:2211): (collagen type VI alpha 1 chain) The collagens are a superfamily of proteins that play a role in maintaining the integrity of various tissues. Collagens are extracellular matrix proteins and have a triple-helical domain as their common structural element. Collagen VI is a major structural component of microfibrils. The basic structural unit of collagen VI is a heterotrimer of the alpha1(VI), alpha2(VI), and alpha3(VI) chains. The alpha2(VI) and alpha3(VI) chains are encoded by the COL6A2 and COL6A3 genes, respectively. The protein encoded by this gene is the alpha 1 subunit of type VI collagen (alpha1(VI) chain). Mutations in the genes that code for the collagen VI subunits result in the autosomal dominant disorder, Bethlem myopathy. [provided by RefSeq, Jul 2008]

COL6A1 Gene-Disease associations (from GenCC):

• Bethlem myopathy 1A

  Inheritance: AR, AD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, G2P
• collagen 6-related myopathy

  Inheritance: SD, AD, AR Classification: DEFINITIVE Submitted by: ClinGen
• Ullrich congenital muscular dystrophy 1A

  Inheritance: AD, AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp
• Bethlem myopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Ullrich congenital muscular dystrophy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -12 ACMG points.

• BP6: Variant 21-46002718-TGGGGCCACCCGGGCAGTCCCAGATCTGCGTAGGTGCGCGC-T is Benign according to our data. Variant chr21-46002718-TGGGGCCACCCGGGCAGTCCCAGATCTGCGTAGGTGCGCGC-T is described in ClinVar as Benign/Likely_benign. ClinVar VariationId is 421765.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS2: High Homozygotes in GnomAd4 at 8 AR,AD gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001848.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	COL6A1	NM_001848.3	MANE Select	c.2434+15_2434+54delACCCGGGCAGTCCCAGATCTGCGTAGGTGCGCGCGGGGCC		intron	N/A	NP_001839.2	P12109

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	COL6A1	ENST00000361866.8	TSL:1 MANE Select	c.2434+9_2434+48delGGGGCCACCCGGGCAGTCCCAGATCTGCGTAGGTGCGCGC		intron	N/A	ENSP00000355180.3	P12109
	COL6A1	ENST00000498614.5	TSL:1	n.668+9_668+48delGGGGCCACCCGGGCAGTCCCAGATCTGCGTAGGTGCGCGC		intron	N/A
	COL6A1	ENST00000866134.1		c.748+9_748+48delGGGGCCACCCGGGCAGTCCCAGATCTGCGTAGGTGCGCGC		intron	N/A	ENSP00000536193.1

Frequencies

GnomAD3 genomes AF: 0.00729 AC: 1098 AN: 150614 Hom.: 8 Cov.: 35

Gnomad AFR AF: 0.0228

Gnomad AMI AF: 0.00111

Gnomad AMR AF: 0.00224

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000391

Gnomad SAS AF: 0.000837

Gnomad FIN AF: 0.000667

Gnomad MID AF: 0.00633

Gnomad NFE AF: 0.00162

Gnomad OTH AF: 0.00579

GnomAD2 exomes AF: 0.000741 AC: 182 AN: 245736 AF XY: 0.000690

Gnomad AFR exome AF: 0.00791

Gnomad AMR exome AF: 0.000493

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.0000547

Gnomad FIN exome AF: 0.000142

Gnomad NFE exome AF: 0.000265

Gnomad OTH exome AF: 0.000332

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00104 AC: 1508 AN: 1456832 Hom.: 25 AF XY: 0.000992 AC XY: 719 AN XY: 724520

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0180 AC: 594 AN: 33026

American (AMR) AF: 0.00135 AC: 60 AN: 44556

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26086

East Asian (EAS) AF: 0.000152 AC: 6 AN: 39584

South Asian (SAS) AF: 0.000210 AC: 18 AN: 85816

European-Finnish (FIN) AF: 0.000498 AC: 26 AN: 52214

Middle Eastern (MID) AF: 0.00105 AC: 6 AN: 5738

European-Non Finnish (NFE) AF: 0.000635 AC: 705 AN: 1109648

Other (OTH) AF: 0.00155 AC: 93 AN: 60164

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.00729 AC: 1099 AN: 150724 Hom.: 8 Cov.: 35 AF XY: 0.00695 AC XY: 512 AN XY: 73690

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0228 AC: 928 AN: 40708

American (AMR) AF: 0.00224 AC: 34 AN: 15184

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3456

East Asian (EAS) AF: 0.000392 AC: 2 AN: 5100

South Asian (SAS) AF: 0.000838 AC: 4 AN: 4772

European-Finnish (FIN) AF: 0.000667 AC: 7 AN: 10500

Middle Eastern (MID) AF: 0.00340 AC: 1 AN: 294

European-Non Finnish (NFE) AF: 0.00162 AC: 110 AN: 67712

Other (OTH) AF: 0.00573 AC: 12 AN: 2096

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

Alfa AF: 0.000223 Hom.: 0

ClinVar

ClinVar submissions

Significance: Benign/Likely benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	1	Bethlem myopathy 1A (1)
-	-	1	not provided (1)
-	-	1	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.50
Mutation Taster		=100/0	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1064795349; hg19: chr21-47422632;