chr21-46117386-CCCTTCTCCTTCAGGGCAAGCTGGGGCGCATCGGACCTCCTGGCT-C
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_001849.4(COL6A2):c.1000-13_1030delCCTTCTCCTTCAGGGCAAGCTGGGGCGCATCGGACCTCCTGGCT(p.Gly334fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_001849.4 frameshift, splice_acceptor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- collagen 6-related myopathyInheritance: AD, SD, AR Classification: DEFINITIVE Submitted by: ClinGen
- Ullrich congenital muscular dystrophy 1BInheritance: AR, AD Classification: DEFINITIVE Submitted by: G2P
- Bethlem myopathy 1AInheritance: AD, AR Classification: STRONG Submitted by: Genomics England PanelApp
- Ullrich congenital muscular dystrophy 1AInheritance: AR, AD Classification: STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
- Bethlem myopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Ullrich congenital muscular dystrophyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- myosclerosisInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001849.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| COL6A2 | MANE Select | c.1000-13_1030delCCTTCTCCTTCAGGGCAAGCTGGGGCGCATCGGACCTCCTGGCT | p.Gly334fs | frameshift splice_acceptor splice_region intron | Exon 11 of 28 | NP_001840.3 | |||
| COL6A2 | MANE Plus Clinical | c.1000-13_1030delCCTTCTCCTTCAGGGCAAGCTGGGGCGCATCGGACCTCCTGGCT | p.Gly334fs | frameshift splice_acceptor splice_region intron | Exon 11 of 28 | NP_478054.2 | P12110-2 | ||
| COL6A2 | c.1000-13_1030delCCTTCTCCTTCAGGGCAAGCTGGGGCGCATCGGACCTCCTGGCT | p.Gly334fs | frameshift splice_acceptor splice_region intron | Exon 11 of 28 | NP_478055.2 | P12110-3 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| COL6A2 | TSL:1 MANE Select | c.1000-13_1030delCCTTCTCCTTCAGGGCAAGCTGGGGCGCATCGGACCTCCTGGCT | p.Gly334fs | frameshift splice_acceptor splice_region intron | Exon 11 of 28 | ENSP00000300527.4 | P12110-1 | ||
| COL6A2 | TSL:5 MANE Plus Clinical | c.1000-13_1030delCCTTCTCCTTCAGGGCAAGCTGGGGCGCATCGGACCTCCTGGCT | p.Gly334fs | frameshift splice_acceptor splice_region intron | Exon 11 of 28 | ENSP00000380870.1 | P12110-2 | ||
| COL6A2 | c.1000-13_1030delCCTTCTCCTTCAGGGCAAGCTGGGGCGCATCGGACCTCCTGGCT | p.Gly334fs | frameshift splice_acceptor splice_region intron | Exon 11 of 28 | ENSP00000527157.1 |
Frequencies
GnomAD3 genomes Cov.: 34
GnomAD4 genome Cov.: 34
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at