rs1555873353

Positions:

• chr21-46117386-CCCTTCTCCTTCAGGGCAAGCTGGGGCGCATCGGACCTCCTGGCT-C

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_001849.4(COL6A2):​c.1000-13_1030delCCTTCTCCTTCAGGGCAAGCTGGGGCGCATCGGACCTCCTGGCT​(p.Gly334fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 34)
• Consequence: COL6A2 NM_001849.4 frameshift, splice_acceptor, splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 2.44

Genes affected

COL6A2 (HGNC:2212): (collagen type VI alpha 2 chain) This gene encodes one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The product of this gene contains several domains similar to von Willebrand Factor type A domains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in this gene are associated with Bethlem myopathy and Ullrich scleroatonic muscular dystrophy. Three transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]

COL6A2 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 21-46117386-CCCTTCTCCTTCAGGGCAAGCTGGGGCGCATCGGACCTCCTGGCT-C is Pathogenic according to our data. Variant chr21-46117386-CCCTTCTCCTTCAGGGCAAGCTGGGGCGCATCGGACCTCCTGGCT-C is described in ClinVar as [Likely_pathogenic]. Clinvar id is 476445.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
COL6A2	NM_001849.4	c.1000-13_1030delCCTTCTCCTTCAGGGCAAGCTGGGGCGCATCGGACCTCCTGGCT	p.Gly334fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	11/28	ENST00000300527.9	NP_001840.3
COL6A2	NM_058174.3	c.1000-13_1030delCCTTCTCCTTCAGGGCAAGCTGGGGCGCATCGGACCTCCTGGCT	p.Gly334fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	11/28		NP_478054.2
COL6A2	NM_058175.3	c.1000-13_1030delCCTTCTCCTTCAGGGCAAGCTGGGGCGCATCGGACCTCCTGGCT	p.Gly334fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	11/28		NP_478055.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
COL6A2	ENST00000300527.9	c.1000-13_1030delCCTTCTCCTTCAGGGCAAGCTGGGGCGCATCGGACCTCCTGGCT	p.Gly334fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	11/28	1	NM_001849.4	ENSP00000300527.4
COL6A2	ENST00000397763.6	c.1000-13_1030delCCTTCTCCTTCAGGGCAAGCTGGGGCGCATCGGACCTCCTGGCT	p.Gly334fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	11/28	5		ENSP00000380870.1
COL6A2	ENST00000409416.6	c.1000-13_1030delCCTTCTCCTTCAGGGCAAGCTGGGGCGCATCGGACCTCCTGGCT	p.Gly334fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	10/27	5		ENSP00000387115.1
COL6A2	ENST00000485591.1	n.656-13_686delCCTTCTCCTTCAGGGCAAGCTGGGGCGCATCGGACCTCCTGGCT		splice_acceptor_variant, splice_region_variant, intron_variant, non_coding_transcript_exon_variant	7/7	3

Frequencies

GnomAD3 genomes Cov.: 34

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 34

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Bethlem myopathy 1A Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

May 10, 2019

This sequence change affects an acceptor splice site in intron 10 of the COL6A2 gene. It is expected to disrupt RNA splicing and likely results in an absent or disrupted protein product. This variant also deletes the first 30 nucleotides of exon 11, disrupting 10 amino acid residues. While this particular variant has not been reported in the literature, a similar variant also affecting the donor splice site in intron 10 (c.1000-2A>G) has been reported in the heterozygous state in an individual affected with Bethlem myopathy (PMID: 17886299). In this individual the splice site variant was shown to cause skipping of exon 11, resulting in autosomal dominant disease. In summary, donor and acceptor splice site variants are typically loss-of-function (PMID: 16199547), and loss-of-function variants in COL6A2 are known to be pathogenic in autosomal recessive COL6A2-related conditions (PMID: 21280092, 20976770). In addition, other mutations that delete a portion of the protein, such as those resulting in exon skipping, have also been identified in autosomal dominant COL6A2-related conditions (PMID: 1788629). However, without additional functional and/or genetic data, this variant has been classified as Likely Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555873353; hg19: chr21-47537300;