chr22-41176877-AGCCACCCAGAGCCCAGGCGATTCTC-A

Variant names:

• chr22-41176877-AGCCACCCAGAGCCCAGGCGATTCTC-A
• rs1555912112
• NM_001429.4:c.5170_5194delACCCAGAGCCCAGGCGATTCTCGCC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_001429.4(EP300):​c.5170_5194delACCCAGAGCCCAGGCGATTCTCGCC​(p.Thr1724AlafsTer2) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. T1724T) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: EP300 NM_001429.4 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.32
• Publications: 0 publications found

Genes affected

EP300 (HGNC:3373): (E1A binding protein p300) This gene encodes the adenovirus E1A-associated cellular p300 transcriptional co-activator protein. It functions as histone acetyltransferase that regulates transcription via chromatin remodeling and is important in the processes of cell proliferation and differentiation. It mediates cAMP-gene regulation by binding specifically to phosphorylated CREB protein. This gene has also been identified as a co-activator of HIF1A (hypoxia-inducible factor 1 alpha), and thus plays a role in the stimulation of hypoxia-induced genes such as VEGF. Defects in this gene are a cause of Rubinstein-Taybi syndrome and may also play a role in epithelial cancer. [provided by RefSeq, Jul 2008]

EP300-AS1 (HGNC:50504): (EP300 antisense RNA 1)

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 63 pathogenic variants in the truncated region.
• PP5: Variant 22-41176877-AGCCACCCAGAGCCCAGGCGATTCTC-A is Pathogenic according to our data. Variant chr22-41176877-AGCCACCCAGAGCCCAGGCGATTCTC-A is described in ClinVar as Pathogenic. ClinVar VariationId is 520715.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001429.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EP300	NM_001429.4	MANE Select	c.5170_5194delACCCAGAGCCCAGGCGATTCTCGCC	p.Thr1724AlafsTer2	frameshift	Exon 31 of 31	NP_001420.2	Q09472
	EP300	NM_001362843.2		c.5092_5116delACCCAGAGCCCAGGCGATTCTCGCC	p.Thr1698AlafsTer2	frameshift	Exon 30 of 30	NP_001349772.1	A0A669KB12

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EP300	ENST00000263253.9	TSL:1 MANE Select	c.5170_5194delACCCAGAGCCCAGGCGATTCTCGCC	p.Thr1724AlafsTer2	frameshift	Exon 31 of 31	ENSP00000263253.7	Q09472
	EP300	ENST00000916082.1		c.5200_5224delACCCAGAGCCCAGGCGATTCTCGCC	p.Thr1734AlafsTer2	frameshift	Exon 31 of 31	ENSP00000586141.1
	EP300	ENST00000715703.1		c.5170_5194delACCCAGAGCCCAGGCGATTCTCGCC	p.Thr1724AlafsTer2	frameshift	Exon 31 of 31	ENSP00000520505.1	Q09472

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Inborn genetic diseases (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555912112; hg19: chr22-41572881;