rs1555912112

Variant names:

• chr22-41176877-AGCCACCCAGAGCCCAGGCGATTCTC-A
• rs1555912112
• NM_001429.4:c.5170_5194delACCCAGAGCCCAGGCGATTCTCGCC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_001429.4(EP300):​c.5170_5194delACCCAGAGCCCAGGCGATTCTCGCC​(p.Thr1724AlafsTer2) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. T1724T) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: EP300 NM_001429.4 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.32
• Publications: 0 publications found

Genes affected

EP300 (HGNC:3373): (E1A binding protein p300) This gene encodes the adenovirus E1A-associated cellular p300 transcriptional co-activator protein. It functions as histone acetyltransferase that regulates transcription via chromatin remodeling and is important in the processes of cell proliferation and differentiation. It mediates cAMP-gene regulation by binding specifically to phosphorylated CREB protein. This gene has also been identified as a co-activator of HIF1A (hypoxia-inducible factor 1 alpha), and thus plays a role in the stimulation of hypoxia-induced genes such as VEGF. Defects in this gene are a cause of Rubinstein-Taybi syndrome and may also play a role in epithelial cancer. [provided by RefSeq, Jul 2008]

EP300-AS1 (HGNC:50504): (EP300 antisense RNA 1)

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 62 pathogenic variants in the truncated region.
• PP5: Variant 22-41176877-AGCCACCCAGAGCCCAGGCGATTCTC-A is Pathogenic according to our data. Variant chr22-41176877-AGCCACCCAGAGCCCAGGCGATTCTC-A is described in ClinVar as Pathogenic. ClinVar VariationId is 520715.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
EP300	NM_001429.4	c.5170_5194delACCCAGAGCCCAGGCGATTCTCGCC	p.Thr1724AlafsTer2	frameshift_variant	Exon 31 of 31	ENST00000263253.9	NP_001420.2
EP300	NM_001362843.2	c.5092_5116delACCCAGAGCCCAGGCGATTCTCGCC	p.Thr1698AlafsTer2	frameshift_variant	Exon 30 of 30		NP_001349772.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
EP300	ENST00000263253.9	c.5170_5194delACCCAGAGCCCAGGCGATTCTCGCC	p.Thr1724AlafsTer2	frameshift_variant	Exon 31 of 31	1	NM_001429.4	ENSP00000263253.7

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Inborn genetic diseases Pathogenic:1

Dec 13, 2024

Ambry Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.5170_5194delACCCAGAGCCCAGGCGATTCTCGCC (p.T1724Afs*2) alteration, located in exon 31 (coding exon 31) of the EP300 gene, consists of a deletion of 25 nucleotides from position 5170 to 5194, causing a translational frameshift with a predicted alternate stop codon after 2 amino acids. This variant is not expected to trigger nonsense-mediated mRNA decay, and impacts the last 29% of the protein. However, premature stop codons are typically deleterious in nature, and the impacted region is critical for protein function (Ambry internal data). This variant was not reported in population-based cohorts in the Genome Aggregation Database (gnomAD). Based on the available evidence, this alteration is classified as pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555912112; hg19: chr22-41572881;