chr22-45795354-G-GATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT

Variant names:

• chr22-45795354-G-GATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT
• rs60726084
• NM_013236.4:c.1174-11594_1174-11535dupATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_013236.4(ATXN10):​c.1174-11594_1174-11535dupATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT variant causes a intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 0)
• Consequence: ATXN10 NM_013236.4 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.237
• Publications: 1 publications found

Genes affected

ATXN10 (HGNC:10549): (ataxin 10) This gene encodes a protein that may function in neuron survival, neuron differentiation, and neuritogenesis. These roles may be carried out via activation of the mitogen-activated protein kinase cascade. Expansion of an ATTCT repeat from 9-32 copies to 800-4500 copies in an intronic region of this locus has been associated with spinocerebellar ataxia, type 10. Alternatively spliced transcript variants have been described.[provided by RefSeq, Jul 2016]

ATXN10 Gene-Disease associations (from GenCC):

• spinocerebellar ataxia type 10

  Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ATXN10	NM_013236.4	c.1174-11594_1174-11535dupATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT		intron_variant	Intron 9 of 11	ENST00000252934.10	NP_037368.1
ATXN10	NM_001167621.2	c.982-11594_982-11535dupATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT		intron_variant	Intron 8 of 10		NP_001161093.1
ATXN10	XM_047441314.1	c.1174-11594_1174-11535dupATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT		intron_variant	Intron 9 of 11		XP_047297270.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ATXN10	ENST00000252934.10	c.1174-11605_1174-11604insATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT		intron_variant	Intron 9 of 11	1	NM_013236.4	ENSP00000252934.4

Frequencies

GnomAD3 genomes Cov.: 0

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.24

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs60726084; hg19: chr22-46191234;