chr3-10141769-AGCGCGCACGCAGCTCCGCCCCGCGTCCGACCCGCGGATCCCGCGGC-A

Position:

• chr3-10141769-AGCGCGCACGCAGCTCCGCCCCGCGTCCGACCCGCGGATCCCGCGGC-A

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_000551.4(VHL):​c.-78_-33delGCGCGCACGCAGCTCCGCCCCGCGTCCGACCCGCGGATCCCGCGGC variant causes a 5 prime UTR change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (no stars).

• Frequency: Genomes: not found (cov: 33)
• Consequence: VHL NM_000551.4 5_prime_UTR
• Clinical Significance: Uncertain significance no assertion criteria provided U:1
• Conservation: PhyloP100: 3.83

Genes affected

VHL (HGNC:12687): (von Hippel-Lindau tumor suppressor) This gene encodes a component of a ubiquitination complex. The encoded protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. In addition to oxygen-related gene expression, this protein plays a role in many other cellular processes including cilia formation, cytokine signaling, regulation of senescence, and formation of the extracellular matrix. Variants of this gene are associated with von Hippel-Lindau syndrome, pheochromocytoma, erythrocytosis, renal cell carcinoma, and cerebellar hemangioblastoma. [provided by RefSeq, Jun 2022]

VHL (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
VHL	NM_000551.4	c.-78_-33delGCGCGCACGCAGCTCCGCCCCGCGTCCGACCCGCGGATCCCGCGGC		5_prime_UTR_variant	1/3	ENST00000256474.3	NP_000542.1
VHL	NM_000551.4	c.-78_-33delGCGCGCACGCAGCTCCGCCCCGCGTCCGACCCGCGGATCCCGCGGC		non_coding_transcript_variant		ENST00000256474.3	NP_000542.1
VHL	NM_000551.4	c.-78_-33delGCGCGCACGCAGCTCCGCCCCGCGTCCGACCCGCGGATCCCGCGGC		upstream_gene_variant		ENST00000256474.3	NP_000542.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
VHL	ENST00000256474	c.-78_-33delGCGCGCACGCAGCTCCGCCCCGCGTCCGACCCGCGGATCCCGCGGC		5_prime_UTR_variant	1/3	1	NM_000551.4	ENSP00000256474.3
VHL	ENST00000256474.3	c.-78_-33delGCGCGCACGCAGCTCCGCCCCGCGTCCGACCCGCGGATCCCGCGGC		non_coding_transcript_variant		1	NM_000551.4	ENSP00000256474.3
VHL	ENST00000256474.3	c.-78_-33delGCGCGCACGCAGCTCCGCCCCGCGTCCGACCCGCGGATCCCGCGGC		upstream_gene_variant		1	NM_000551.4	ENSP00000256474.3

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: no assertion criteria provided

Submissions by phenotype

Von Hippel-Lindau syndrome Uncertain:1

Uncertain significance, no assertion criteria provided

clinical testing

PreventionGenetics, part of Exact Sciences

Aug 24, 2017

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553619239; hg19: chr3-10183453;