rs1553619239
Variant summary
Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PS3PP5_Moderate
The NM_000551.4(VHL):c.-78_-33delGCGCGCACGCAGCTCCGCCCCGCGTCCGACCCGCGGATCCCGCGGC variant causes a 5 prime UTR change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). ClinVar reports functional evidence for this variant: "SCV006188612: This variant deletes a region of the VHL promoter that is predicted to be critical for VHL transcription and protein expression (Zatyka M et al. J Med Genet, 2002 Jul" and additional evidence is available in ClinVar.
Frequency
Consequence
NM_000551.4 5_prime_UTR
Scores
Clinical Significance
Conservation
Publications
- pheochromocytomaInheritance: AD Classification: DEFINITIVE Submitted by: G2P
- von Hippel-Lindau diseaseInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, ClinGen, Genomics England PanelApp, G2P
- renal cell carcinomaInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- autosomal recessive secondary polycythemia not associated with VHL geneInheritance: AR Classification: STRONG Submitted by: Ambry Genetics
- Chuvash polycythemiaInheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet
- hereditary pheochromocytoma-paragangliomaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 6 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000551.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| VHL | MANE Select | c.-78_-33delGCGCGCACGCAGCTCCGCCCCGCGTCCGACCCGCGGATCCCGCGGC | 5_prime_UTR | Exon 1 of 3 | NP_000542.1 | A0A024R2F2 | |||
| VHL | MANE Select | c.-78_-33delGCGCGCACGCAGCTCCGCCCCGCGTCCGACCCGCGGATCCCGCGGC | non_coding_transcript | N/A | NP_000542.1 | A0A024R2F2 | |||
| VHL | c.-78_-33delGCGCGCACGCAGCTCCGCCCCGCGTCCGACCCGCGGATCCCGCGGC | 5_prime_UTR | Exon 1 of 3 | NP_001341652.1 | A0A8Q3WL21 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| VHL | TSL:1 MANE Select | c.-78_-33delGCGCGCACGCAGCTCCGCCCCGCGTCCGACCCGCGGATCCCGCGGC | 5_prime_UTR | Exon 1 of 3 | ENSP00000256474.3 | P40337-1 | |||
| VHL | TSL:1 | c.-78_-33delGCGCGCACGCAGCTCCGCCCCGCGTCCGACCCGCGGATCCCGCGGC | 5_prime_UTR | Exon 1 of 2 | ENSP00000344757.2 | P40337-2 | |||
| VHL | TSL:1 MANE Select | c.-78_-33delGCGCGCACGCAGCTCCGCCCCGCGTCCGACCCGCGGATCCCGCGGC | non_coding_transcript | N/A | ENSP00000256474.3 | P40337-1 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at