rs1553619239

Variant names:

• chr3-10141769-AGCGCGCACGCAGCTCCGCCCCGCGTCCGACCCGCGGATCCCGCGGC-A
• rs1553619239
• ENST00000477538.2:n.-32_14delGCGCGCACGCAGCTCCGCCCCGCGTCCGACCCGCGGATCCCGCGGC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PP5_Moderate

The ENST00000477538.2(VHL):​n.-32_14delGCGCGCACGCAGCTCCGCCCCGCGTCCGACCCGCGGATCCCGCGGC variant causes a non coding transcript exon change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: VHL ENST00000477538.2 non_coding_transcript_exon
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1 U:1
• Conservation: PhyloP100: 3.83
• Publications: 1 publications found

Genes affected

VHL (HGNC:12687): (von Hippel-Lindau tumor suppressor) This gene encodes a component of a ubiquitination complex. The encoded protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. In addition to oxygen-related gene expression, this protein plays a role in many other cellular processes including cilia formation, cytokine signaling, regulation of senescence, and formation of the extracellular matrix. Variants of this gene are associated with von Hippel-Lindau syndrome, pheochromocytoma, erythrocytosis, renal cell carcinoma, and cerebellar hemangioblastoma. [provided by RefSeq, Jun 2022]

VHL Gene-Disease associations (from GenCC):

• pheochromocytoma

  Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
• von Hippel-Lindau disease

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), G2P, Orphanet
• renal cell carcinoma

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• autosomal recessive secondary polycythemia not associated with VHL gene

  Inheritance: AR Classification: STRONG Submitted by: Ambry Genetics
• Chuvash polycythemia

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet
• hereditary pheochromocytoma-paraganglioma

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PP5: Variant 3-10141769-AGCGCGCACGCAGCTCCGCCCCGCGTCCGACCCGCGGATCCCGCGGC-A is Pathogenic according to our data. Variant chr3-10141769-AGCGCGCACGCAGCTCCGCCCCGCGTCCGACCCGCGGATCCCGCGGC-A is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 433541.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
VHL	NM_000551.4	c.-78_-33delGCGCGCACGCAGCTCCGCCCCGCGTCCGACCCGCGGATCCCGCGGC		5_prime_UTR_variant	Exon 1 of 3	ENST00000256474.3	NP_000542.1
VHL	NM_000551.4	c.-78_-33delGCGCGCACGCAGCTCCGCCCCGCGTCCGACCCGCGGATCCCGCGGC		non_coding_transcript_variant		ENST00000256474.3	NP_000542.1
VHL	NM_000551.4	c.-78_-33delGCGCGCACGCAGCTCCGCCCCGCGTCCGACCCGCGGATCCCGCGGC		upstream_gene_variant		ENST00000256474.3	NP_000542.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
VHL	ENST00000256474.3	c.-78_-33delGCGCGCACGCAGCTCCGCCCCGCGTCCGACCCGCGGATCCCGCGGC		5_prime_UTR_variant	Exon 1 of 3	1	NM_000551.4	ENSP00000256474.3
VHL	ENST00000256474.3	c.-78_-33delGCGCGCACGCAGCTCCGCCCCGCGTCCGACCCGCGGATCCCGCGGC		non_coding_transcript_variant		1	NM_000551.4	ENSP00000256474.3
VHL	ENST00000256474.3	c.-78_-33delGCGCGCACGCAGCTCCGCCCCGCGTCCGACCCGCGGATCCCGCGGC		upstream_gene_variant		1	NM_000551.4	ENSP00000256474.3

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1 Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Hereditary cancer-predisposing syndrome Pathogenic:1

Jun 02, 2025

Ambry Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.-77_-32del46 variant is located in the 5' untranslated region (5'UTR) of the VHL gene. This variant results from a deletion of 46 nucleotides at positions c.-77 to c.-32. This variant was reported in individuals with features consistent with von Hippel-Lindau syndrome (Albanyan S et al. Eur J Med Genet, 2019 Mar;62:177-181). This variant deletes a region of the VHL promoter that is predicted to be critical for VHL transcription and protein expression (Zatyka M et al. J Med Genet, 2002 Jul;39:463-72). Other variants impacting the same region have been identified in individuals with features consistent with von Hippel-Lindau syndrome (Ambry internal data). Based on the majority of available evidence to date, this variant is likely to be pathogenic. -

Von Hippel-Lindau syndrome Uncertain:1

Aug 24, 2017

PreventionGenetics, part of Exact Sciences

Significance: Uncertain significance

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.8
Mutation Taster		=101/199	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553619239; hg19: chr3-10183453;