chr3-128483319-AGGCTGCAGATGTCCGGATAGGAAACTCC-A
Variant summary
Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PP3PP5_Moderate
The NM_032638.5(GATA2):c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC variant causes a intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).
Frequency
Consequence
NM_032638.5 intron
Scores
Clinical Significance
Conservation
Publications
- deafness-lymphedema-leukemia syndromeInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
- GATA2 deficiency with susceptibility to MDS/AMLInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- monocytopenia with susceptibility to infectionsInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics
- acute myeloid leukemiaInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- myelodysplastic syndromeInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 3 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_032638.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| GATA2 | MANE Plus Clinical | c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC | intron | N/A | NP_001139133.1 | P23769-1 | |||
| GATA2 | MANE Select | c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC | intron | N/A | NP_116027.2 | ||||
| GATA2 | c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC | intron | N/A | NP_001139134.1 | P23769-2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| GATA2 | TSL:1 MANE Select | c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC | intron | N/A | ENSP00000345681.2 | P23769-1 | |||
| GATA2 | TSL:1 MANE Plus Clinical | c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC | intron | N/A | ENSP00000417074.1 | P23769-1 | |||
| GATA2 | TSL:1 | c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC | intron | N/A | ENSP00000400259.2 | P23769-2 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at