rs1553770655

Variant names:

• chr3-128483319-AGGCTGCAGATGTCCGGATAGGAAACTCC-A
• rs1553770655
• NM_001145661.2:c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PP3 PP5_Moderate

The NM_032638.5(GATA2):​c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC variant causes a intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: GATA2 NM_032638.5 intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 8.53
• Publications: 1 publications found

Genes affected

GATA2 (HGNC:4171): (GATA binding protein 2) This gene encodes a member of the GATA family of zinc-finger transcription factors that are named for the consensus nucleotide sequence they bind in the promoter regions of target genes. The encoded protein plays an essential role in regulating transcription of genes involved in the development and proliferation of hematopoietic and endocrine cell lineages. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009]

GATA2 Gene-Disease associations (from GenCC):

• deafness-lymphedema-leukemia syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, Genomics England PanelApp
• GATA2 deficiency with susceptibility to MDS/AML

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• monocytopenia with susceptibility to infections

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics
• acute myeloid leukemia

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• myelodysplastic syndrome

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 3-128483319-AGGCTGCAGATGTCCGGATAGGAAACTCC-A is Pathogenic according to our data. Variant chr3-128483319-AGGCTGCAGATGTCCGGATAGGAAACTCC-A is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 39587.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_032638.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GATA2	NM_001145661.2	MANE Plus Clinical	c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC		intron	N/A	NP_001139133.1
	GATA2	NM_032638.5	MANE Select	c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC		intron	N/A	NP_116027.2
	GATA2	NM_001145662.1		c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC		intron	N/A	NP_001139134.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GATA2	ENST00000341105.7	TSL:1 MANE Select	c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC		intron	N/A	ENSP00000345681.2
	GATA2	ENST00000487848.6	TSL:1 MANE Plus Clinical	c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC		intron	N/A	ENSP00000417074.1
	GATA2	ENST00000430265.6	TSL:1	c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC		intron	N/A	ENSP00000400259.2

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions as Germline

Significance: Likely pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Deafness-lymphedema-leukemia syndrome;CN300066:GATA2 deficiency with susceptibility to MDS/AML (1)
1	-	-	Monocytopenia with susceptibility to infections (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.5
Mutation Taster		=6/94	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553770655; hg19: chr3-128202162;