chr3-169763862-ATCCTAAGGAATTGAAGGTATGGATTTGGGACGGAATTACCTTGTCGTGATAAGTGGGCAGAATGGCCTGTTTGTTTCTTTCAACCTAGTGGGCCATTAGCTTATTTTCTTAAAGGAAATCAGAGCCAATTCTTGTGGGAGACTGCCGGCTGGGAGGGTTGGGGGTGGGGGGTGTGGAATAAATTTCTTTTCCGTCTTTCATTATGCCTAGTGTTCCGTTATTGGAACGCTAAGCTTGTGGGGGTTATATCCTACTGCTCAAGGTCATCGCCAAGGTCTAATTTTTCAAAAAAGAAACTTCTAACCTCTGGCATAAACCGATGACCATTAAAGGAACACAATTTCCAATGTTCATTTAGATCTTCTAATTAAATATTCATTAAATGTTAAATGATCTCTCAAAAAAAAATGACTGTTCTCCCACACCCCGTTGAGGGGACTGGTCGAGATCTACCTTGGGAGAAGCAAAAACCTCAACAAAATCTGCAGAGCAGGAACTAAGTTGTAATACAACCATAAAAGGCAACAAAAAGCGGAAGACGGGAGAACCCACGCAGGAACGGCTCCAGGCAACCCCGGCTCACTGCCCATTCATTTTGGCCGACTTTGGAGGTGCCTTCACGTCTCCTGCCAATTTGCAGCACACTGGCCCAGTCAGTCAGGTTTGGGGGTTCACAAGCCCCCATTGCCGGCGAGGGGTGACGGATGCGCACGATCGGCGTTCCCCCCACCAACAGGAAAGCGAACTGCATGTGTGAGCCGAGTCCTGGGTGCACGTCCCACAGCTCAGGGAATCGCGCCGCGCGCGGGGACTCGCTCCGT-A
Variant summary
Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2
The NR_001566.3(TERC):n.378_*747del variant causes a splice region, non coding transcript exon change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Genomes: not found (cov: 32)
Consequence
TERC
NR_001566.3 splice_region, non_coding_transcript_exon
NR_001566.3 splice_region, non_coding_transcript_exon
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 0.617
Genes affected
TERC (HGNC:11727): (telomerase RNA component) Telomerase is a ribonucleoprotein polymerase that maintains telomere ends by addition of the telomere repeat TTAGGG. The enzyme consists of a protein component with reverse transcriptase activity, and an RNA component, encoded by this gene, that serves as a template for the telomere repeat. Telomerase expression plays a role in cellular senescence, as it is normally repressed in postnatal somatic cells resulting in progressive shortening of telomeres. Deregulation of telomerase expression in somatic cells may be involved in oncogenesis. Studies in mouse suggest that telomerase also participates in chromosomal repair, since de novo synthesis of telomere repeats may occur at double-stranded breaks. Mutations in this gene cause autosomal dominant dyskeratosis congenita, and may also be associated with some cases of aplastic anemia. [provided by RefSeq, Jul 2008]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Uncertain_significance. Variant got 2 ACMG points.
PM2
Very rare variant in population databases, with high coverage;
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
Telomerase-vert | ENST00000363312.1 | n.365_*747del | splice_region_variant, non_coding_transcript_exon_variant | 1/1 | 6 | |||||
TERC | ENST00000602385.1 | n.378_*657del | splice_region_variant, non_coding_transcript_exon_variant | 1/1 | 6 | |||||
Telomerase-vert | ENST00000363312.1 | n.365_*747del | downstream_gene_variant | 6 | ||||||
TERC | ENST00000602385.1 | n.378_*657del | downstream_gene_variant | 6 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:3
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Dyskeratosis congenita, autosomal dominant 1 Pathogenic:3
Pathogenic, no assertion criteria provided | curation | GeneReviews | May 10, 2012 | - - |
Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Jan 20, 2025 | This variant occurs in the TERC gene, which encodes an RNA molecule that does not result in a protein product. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with dyskeratosis congenita (PMID: 11574891; internal data). It has also been observed to segregate with disease in related individuals. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant is located within the BoxH/ACA scaRNA domain of the TERC RNA component, which is required for telomerase activity (PMID: 21844345). For these reasons, this variant has been classified as Pathogenic. - |
Pathogenic, no assertion criteria provided | literature only | OMIM | Sep 27, 2001 | - - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at