chr3-33068937-T-TGGCCAGGGCTCATGAAAGTTCCA

Variant names:

• chr3-33068937-T-TGGCCAGGGCTCATGAAAGTTCCA
• rs587776524
• NM_000404.4:c.256_278dupTGGAACTTTCATGAGCCCTGGCC

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_000404.4(GLB1):​c.256_278dupTGGAACTTTCATGAGCCCTGGCC​(p.Gln95ThrfsTer34) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. P93P) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: GLB1 NM_000404.4 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 3.47
• Publications: 1 publications found

Genes affected

GLB1 (HGNC:4298): (galactosidase beta 1) This gene encodes a member of the glycosyl hydrolase 35 family of proteins. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature lysosomal enzyme. This enzyme catalyzes the hydrolysis of a terminal beta-linked galactose residue from ganglioside substrates and other glycoconjugates. Mutations in this gene may result in GM1-gangliosidosis and Morquio B syndrome. [provided by RefSeq, Nov 2015]

GLB1 Gene-Disease associations (from GenCC):

• GM1 gangliosidosis

  Inheritance: AR Classification: DEFINITIVE Submitted by: Myriad Women’s Health, ClinGen
• GM1 gangliosidosis type 3

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), G2P, Genomics England PanelApp
• mucopolysaccharidosis type 4B

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, ClinGen, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
• GM1 gangliosidosis type 1

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet
• GM1 gangliosidosis type 2

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 3-33068937-T-TGGCCAGGGCTCATGAAAGTTCCA is Pathogenic according to our data. Variant chr3-33068937-T-TGGCCAGGGCTCATGAAAGTTCCA is described in ClinVar as [Pathogenic]. Clinvar id is 934.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
GLB1	NM_000404.4	c.256_278dupTGGAACTTTCATGAGCCCTGGCC	p.Gln95ThrfsTer34	frameshift_variant	Exon 3 of 16	ENST00000307363.10	NP_000395.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
GLB1	ENST00000307363.10	c.256_278dupTGGAACTTTCATGAGCCCTGGCC	p.Gln95ThrfsTer34	frameshift_variant	Exon 3 of 16	1	NM_000404.4	ENSP00000306920.4

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Infantile GM1 gangliosidosis Pathogenic:1

May 01, 1992

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.5
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs587776524; hg19: chr3-33110429;