rs587776524

Positions:

• chr3-33068937-T-TGGCCAGGGCTCATGAAAGTTCCA

Variant summary

Our verdict is Pathogenic. Variant got 11 ACMG points: 11P and 0B. PVS1 PM2 PP5

The NM_000404.4(GLB1):​c.256_278dupTGGAACTTTCATGAGCCCTGGCC​(p.Gln95fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: GLB1 NM_000404.4 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 3.47

Genes affected

GLB1 (HGNC:4298): (galactosidase beta 1) This gene encodes a member of the glycosyl hydrolase 35 family of proteins. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature lysosomal enzyme. This enzyme catalyzes the hydrolysis of a terminal beta-linked galactose residue from ganglioside substrates and other glycoconjugates. Mutations in this gene may result in GM1-gangliosidosis and Morquio B syndrome. [provided by RefSeq, Nov 2015]

GLB1 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 11 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 3-33068937-T-TGGCCAGGGCTCATGAAAGTTCCA is Pathogenic according to our data. Variant chr3-33068937-T-TGGCCAGGGCTCATGAAAGTTCCA is described in ClinVar as [Pathogenic]. Clinvar id is 934.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
GLB1	NM_000404.4	c.256_278dupTGGAACTTTCATGAGCCCTGGCC	p.Gln95fs	frameshift_variant	3/16	ENST00000307363.10	NP_000395.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
GLB1	ENST00000307363.10	c.256_278dupTGGAACTTTCATGAGCCCTGGCC	p.Gln95fs	frameshift_variant	3/16	1	NM_000404.4	ENSP00000306920.4

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Infantile GM1 gangliosidosis Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

May 01, 1992

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs587776524; hg19: chr3-33110429;