rs587776524
Variant summary
Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1PP5
The NM_000404.4(GLB1):c.256_278dupTGGAACTTTCATGAGCCCTGGCC(p.Gln95ThrfsTer34) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. P93P) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000404.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- GM1 gangliosidosisInheritance: AR Classification: DEFINITIVE Submitted by: Myriad Women’s Health, ClinGen
- GM1 gangliosidosis type 3Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), G2P, Genomics England PanelApp
- mucopolysaccharidosis type 4BInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, ClinGen, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
- GM1 gangliosidosis type 1Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet
- GM1 gangliosidosis type 2Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 9 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000404.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| GLB1 | NM_000404.4 | MANE Select | c.256_278dupTGGAACTTTCATGAGCCCTGGCC | p.Gln95ThrfsTer34 | frameshift | Exon 3 of 16 | NP_000395.3 | ||
| GLB1 | NM_001317040.2 | c.400_422dupTGGAACTTTCATGAGCCCTGGCC | p.Gln143ThrfsTer34 | frameshift | Exon 4 of 17 | NP_001303969.2 | |||
| GLB1 | NM_001079811.3 | c.166_188dupTGGAACTTTCATGAGCCCTGGCC | p.Gln65ThrfsTer34 | frameshift | Exon 3 of 16 | NP_001073279.2 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| GLB1 | ENST00000307363.10 | TSL:1 MANE Select | c.256_278dupTGGAACTTTCATGAGCCCTGGCC | p.Gln95ThrfsTer34 | frameshift | Exon 3 of 16 | ENSP00000306920.4 | ||
| GLB1 | ENST00000307377.12 | TSL:1 | c.246-3403_246-3381dupTGGAACTTTCATGAGCCCTGGCC | intron | N/A | ENSP00000305920.8 | |||
| GLB1 | ENST00000399402.7 | TSL:2 | c.166_188dupTGGAACTTTCATGAGCCCTGGCC | p.Gln65ThrfsTer34 | frameshift | Exon 3 of 16 | ENSP00000382333.2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Infantile GM1 gangliosidosis Pathogenic:1
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at