Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_000249.4(MLH1):c.706_725delAAAACCCTAGCCTTCAAAAT(p.Lys236GlufsTer64) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
MLH1 (HGNC:7127): (mutL homolog 1) The protein encoded by this gene can heterodimerize with mismatch repair endonuclease PMS2 to form MutL alpha, part of the DNA mismatch repair system. When MutL alpha is bound by MutS beta and some accessory proteins, the PMS2 subunit of MutL alpha introduces a single-strand break near DNA mismatches, providing an entry point for exonuclease degradation. The encoded protein is also involved in DNA damage signaling and can heterodimerize with DNA mismatch repair protein MLH3 to form MutL gamma, which is involved in meiosis. This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). [provided by RefSeq, Aug 2017]
Verdict is Pathogenic. Variant got 12 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 3-37014457-GATAAAACCCTAGCCTTCAAA-G is Pathogenic according to our data. Variant chr3-37014457-GATAAAACCCTAGCCTTCAAA-G is described in ClinVar as [Pathogenic]. Clinvar id is 216050.Status of the report is criteria_provided_single_submitter, 1 stars.
Review Status: criteria provided, single submitter
Collection Method: clinical testing
This sequence change deletes 20 nucleotides in exon 9 of the MLH1 mRNA (c.704_723delATAAAACCCTAGCCTTCAAA), causing a frameshift at codon 236. This creates a premature translational stop signal (p.Lys236Glufs*64) and is expected to result in an absent or disrupted protein product. While this particular variant has not been reported in the literature, truncating variants in MLH1 are known to be pathogenic (PMID: 15713769, 24362816). For these reasons, this variant has been classified as Pathogenic. -
Review Status: criteria provided, single submitter
Collection Method: clinical testing
This sequence change creates a premature translational stop signal (p.Lys236Glufs*64) in the MLH1 gene. It is expected to result in an absent or disrupted protein product. This variant has not been reported in the literature in individuals with MLH1-related conditions. Loss-of-function variants in MLH1 are known to be pathogenic (PMID: 15713769, 24362816). For these reasons, this variant has been classified as Pathogenic. -