rs863224480
Positions:
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_000249.4(MLH1):c.706_725delAAAACCCTAGCCTTCAAAAT(p.Lys236fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Genomes: not found (cov: 32)
Consequence
MLH1
NM_000249.4 frameshift
NM_000249.4 frameshift
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 8.88
Genes affected
MLH1 (HGNC:7127): (mutL homolog 1) The protein encoded by this gene can heterodimerize with mismatch repair endonuclease PMS2 to form MutL alpha, part of the DNA mismatch repair system. When MutL alpha is bound by MutS beta and some accessory proteins, the PMS2 subunit of MutL alpha introduces a single-strand break near DNA mismatches, providing an entry point for exonuclease degradation. The encoded protein is also involved in DNA damage signaling and can heterodimerize with DNA mismatch repair protein MLH3 to form MutL gamma, which is involved in meiosis. This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). [provided by RefSeq, Aug 2017]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 12 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 3-37014457-GATAAAACCCTAGCCTTCAAA-G is Pathogenic according to our data. Variant chr3-37014457-GATAAAACCCTAGCCTTCAAA-G is described in ClinVar as [Pathogenic]. Clinvar id is 216050.Status of the report is criteria_provided_single_submitter, 1 stars.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Lynch syndrome Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Jun 13, 2015 | This sequence change deletes 20 nucleotides in exon 9 of the MLH1 mRNA (c.704_723delATAAAACCCTAGCCTTCAAA), causing a frameshift at codon 236. This creates a premature translational stop signal (p.Lys236Glufs*64) and is expected to result in an absent or disrupted protein product. While this particular variant has not been reported in the literature, truncating variants in MLH1 are known to be pathogenic (PMID: 15713769, 24362816). For these reasons, this variant has been classified as Pathogenic. - |
Hereditary nonpolyposis colorectal neoplasms Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Aug 15, 2019 | This sequence change creates a premature translational stop signal (p.Lys236Glufs*64) in the MLH1 gene. It is expected to result in an absent or disrupted protein product. This variant has not been reported in the literature in individuals with MLH1-related conditions. Loss-of-function variants in MLH1 are known to be pathogenic (PMID: 15713769, 24362816). For these reasons, this variant has been classified as Pathogenic. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at