chr3-41225138-T-TCAAGATGATGCAGAACTTGCCACACGTGCAATCCCTGAACTGAC

Variant names:

• chr3-41225138-T-TCAAGATGATGCAGAACTTGCCACACGTGCAATCCCTGAACTGAC
• rs1553630304
• NM_001904.4:c.427_470dupCAAGATGATGCAGAACTTGCCACACGTGCAATCCCTGAACTGAC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_001904.4(CTNNB1):​c.427_470dupCAAGATGATGCAGAACTTGCCACACGTGCAATCCCTGAACTGAC​(p.Leu159MetfsTer13) variant causes a frameshift, stop gained change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: CTNNB1 NM_001904.4 frameshift, stop_gained
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 7.91
• Publications: 0 publications found

Genes affected

CTNNB1 (HGNC:2514): (catenin beta 1) The protein encoded by this gene is part of a complex of proteins that constitute adherens junctions (AJs). AJs are necessary for the creation and maintenance of epithelial cell layers by regulating cell growth and adhesion between cells. The encoded protein also anchors the actin cytoskeleton and may be responsible for transmitting the contact inhibition signal that causes cells to stop dividing once the epithelial sheet is complete. Finally, this protein binds to the product of the APC gene, which is mutated in adenomatous polyposis of the colon. Mutations in this gene are a cause of colorectal cancer (CRC), pilomatrixoma (PTR), medulloblastoma (MDB), and ovarian cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]

CTNNB1 Gene-Disease associations (from GenCC):

• exudative vitreoretinopathy

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, G2P
• severe intellectual disability-progressive spastic diplegia syndrome

  Inheritance: AD, Unknown Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Orphanet, Labcorp Genetics (formerly Invitae), Illumina, G2P, Ambry Genetics
• exudative vitreoretinopathy 7

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 3-41225138-T-TCAAGATGATGCAGAACTTGCCACACGTGCAATCCCTGAACTGAC is Pathogenic according to our data. Variant chr3-41225138-T-TCAAGATGATGCAGAACTTGCCACACGTGCAATCCCTGAACTGAC is described in ClinVar as Pathogenic. ClinVar VariationId is 434868.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001904.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CTNNB1	NM_001904.4	MANE Select	c.427_470dupCAAGATGATGCAGAACTTGCCACACGTGCAATCCCTGAACTGAC	p.Leu159MetfsTer13	frameshift stop_gained	Exon 4 of 15	NP_001895.1
	CTNNB1	NM_001098209.2		c.427_470dupCAAGATGATGCAGAACTTGCCACACGTGCAATCCCTGAACTGAC	p.Leu159MetfsTer13	frameshift stop_gained	Exon 4 of 16	NP_001091679.1
	CTNNB1	NM_001098210.2		c.427_470dupCAAGATGATGCAGAACTTGCCACACGTGCAATCCCTGAACTGAC	p.Leu159MetfsTer13	frameshift stop_gained	Exon 4 of 16	NP_001091680.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CTNNB1	ENST00000349496.11	TSL:1 MANE Select	c.427_470dupCAAGATGATGCAGAACTTGCCACACGTGCAATCCCTGAACTGAC	p.Leu159MetfsTer13	frameshift stop_gained	Exon 4 of 15	ENSP00000344456.5
	CTNNB1	ENST00000396183.7	TSL:1	c.427_470dupCAAGATGATGCAGAACTTGCCACACGTGCAATCCCTGAACTGAC	p.Leu159MetfsTer13	frameshift stop_gained	Exon 4 of 16	ENSP00000379486.3
	CTNNB1	ENST00000396185.8	TSL:1	c.427_470dupCAAGATGATGCAGAACTTGCCACACGTGCAATCCCTGAACTGAC	p.Leu159MetfsTer13	frameshift stop_gained	Exon 4 of 16	ENSP00000379488.3

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Severe intellectual disability-progressive spastic diplegia syndrome Pathogenic:1

Jul 07, 2016

Genetic Services Laboratory, University of Chicago

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.9
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553630304; hg19: chr3-41266629;