chr3-49422364-TGCGCAACTAAGTGGACGACACAAGGCCGGGGGGAATGCCTGCAGGCGAAAGCCCAGACGGGCCACCACACTTACAGCCCTCTGCATCGTCGCCTGCAACGAGTGCAGACG-T
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PP5_Moderate
The NM_000481.4(AMT):c.-24_86del variant causes a 5 prime UTR truncation, exon loss change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).
Frequency
Consequence
NM_000481.4 5_prime_UTR_truncation, exon_loss
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000481.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| AMT | MANE Select | c.-24_86del | p.Met1fs | frameshift start_lost | Exon 1 of 9 | NP_000472.2 | |||
| AMT | MANE Select | c.-24_86del | 5_prime_UTR_truncation exon_loss | Exon 1 of 9 | NP_000472.2 | ||||
| NICN1 | MANE Select | c.*2359_*2468del | 3_prime_UTR | Exon 6 of 6 | NP_115692.1 | Q9BSH3-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| AMT | TSL:1 MANE Select | c.-24_86del | p.Met1fs | frameshift start_lost | Exon 1 of 9 | ENSP00000273588.3 | P48728-1 | ||
| AMT | TSL:1 | c.-24_86del | p.Met1fs | frameshift start_lost | Exon 1 of 10 | ENSP00000378747.2 | P48728-4 | ||
| AMT | TSL:1 MANE Select | c.-24_86del | 5_prime_UTR_truncation exon_loss | Exon 1 of 9 | ENSP00000273588.3 | P48728-1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at