chr4-41745975-TGCCGCCGCTGCCGCTGCCGCC-T

Variant names:

• chr4-41745975-TGCCGCCGCTGCCGCTGCCGCC-T
• rs17879189
• NM_003924.4:c.756_776delGGCGGCAGCGGCAGCGGCGGC

Variant summary

Our verdict is Benign. Variant got -17 ACMG points: 0P and 17B. BP3 BP6_Very_Strong BS1 BS2

The NM_003924.4(PHOX2B):​c.756_776delGGCGGCAGCGGCAGCGGCGGC​(p.Ala253_Ala259del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00147 in 1,288,110 control chromosomes in the GnomAD database, including 37 homozygotes. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0019 (3 hom., cov: 32)
  • Exomes 𝑓: 0.0014 (34 hom.)
• Consequence: PHOX2B NM_003924.4 disruptive_inframe_deletion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:8
• Conservation: PhyloP100: 3.23

Genes affected

PHOX2B (HGNC:9143): (paired like homeobox 2B) The DNA-associated protein encoded by this gene is a member of the paired family of homeobox proteins localized to the nucleus. The protein functions as a transcription factor involved in the development of several major noradrenergic neuron populations and the determination of neurotransmitter phenotype. The gene product is linked to enhancement of second messenger-mediated activation of the dopamine beta-hydroylase, c-fos promoters and several enhancers, including cyclic amp-response element and serum-response element. Expansion of a 20 amino acid polyalanine tract in this protein by 5-13 aa has been associated with congenital central hypoventilation syndrome. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Benign. Variant got -17 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_003924.4
• BP6: Variant 4-41745975-TGCCGCCGCTGCCGCTGCCGCC-T is Benign according to our data. Variant chr4-41745975-TGCCGCCGCTGCCGCTGCCGCC-T is described in ClinVar as [Likely_benign]. Clinvar id is 239593.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr4-41745975-TGCCGCCGCTGCCGCTGCCGCC-T is described in Lovd as [Pathogenic].
• BS1: Variant frequency is greater than expected in population amr. gnomad4 allele frequency = 0.00189 (279/147844) while in subpopulation AMR AF= 0.00869 (130/14952). AF 95% confidence interval is 0.00748. There are 3 homozygotes in gnomad4. There are 152 alleles in male gnomad4 subpopulation. Median coverage is 32. This position pass quality control queck.
• BS2: High AC in GnomAd4 at 279 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PHOX2B	NM_003924.4	c.756_776delGGCGGCAGCGGCAGCGGCGGC	p.Ala253_Ala259del	disruptive_inframe_deletion	Exon 3 of 3	ENST00000226382.4	NP_003915.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PHOX2B	ENST00000226382.4	c.756_776delGGCGGCAGCGGCAGCGGCGGC	p.Ala253_Ala259del	disruptive_inframe_deletion	Exon 3 of 3	1	NM_003924.4	ENSP00000226382.2
PHOX2B	ENST00000510424.2	n.*37_*57delGGCGGCAGCGGCAGCGGCGGC		downstream_gene_variant		3

Frequencies

GnomAD3 genomes AF: 0.00189 AC: 279 AN: 147732 Hom.: 3 Cov.: 32

Gnomad AFR AF: 0.000905

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00871

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00574

Gnomad SAS AF: 0.00336

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.0162

Gnomad NFE AF: 0.000873

Gnomad OTH AF: 0.00294

GnomAD3 exomes AF: 0.00825 AC: 421 AN: 51026 Hom.: 9 AF XY: 0.00846 AC XY: 260 AN XY: 30750

Gnomad AFR exome AF: 0.0241

Gnomad AMR exome AF: 0.0280

Gnomad ASJ exome AF: 0.00556

Gnomad EAS exome AF: 0.0436

Gnomad SAS exome AF: 0.0154

Gnomad FIN exome AF: 0.000274

Gnomad NFE exome AF: 0.00366

Gnomad OTH exome AF: 0.00739

GnomAD4 exome AF: 0.00141 AC: 1612 AN: 1140266 Hom.: 34 AF XY: 0.00157 AC XY: 867 AN XY: 551056

Gnomad4 AFR exome AF: 0.00306

Gnomad4 AMR exome AF: 0.0144

Gnomad4 ASJ exome AF: 0.00144

Gnomad4 EAS exome AF: 0.0125

Gnomad4 SAS exome AF: 0.00800

Gnomad4 FIN exome AF: 0.000349

Gnomad4 NFE exome AF: 0.000724

Gnomad4 OTH exome AF: 0.00199

GnomAD4 genome AF: 0.00189 AC: 279 AN: 147844 Hom.: 3 Cov.: 32 AF XY: 0.00211 AC XY: 152 AN XY: 72018

Gnomad4 AFR AF: 0.000903

Gnomad4 AMR AF: 0.00869

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00575

Gnomad4 SAS AF: 0.00336

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000873

Gnomad4 OTH AF: 0.00291

Alfa AF: 0.00141 Hom.: 0

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:8

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Benign:3

May 04, 2022

ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Sep 01, 2024

CeGaT Center for Human Genetics Tuebingen

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

PHOX2B: BS1, BS2 -

May 17, 2016

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: The PHOX2B c.756_776delGGCGGCAGCGGCAGCGGCGGC (p.Ala253_Ala259del) variant causes an in-frame deletion within a repetitive alanine region. The variant of interest was observed in the large, broad control population, ExAC, with an allele frequency of 318/24632 control chromosomes (10 homozygotes, 1/77, frequency: 0.01291), which significantly exceeds the estimated maximal expected allele frequency for a pathogenic PHOX2B variant of 1/1250000 (0.0000008), suggesting this variant is a benign polymorphism. Therefore, the variant of interest is classified as Benign. -

Hereditary cancer-predisposing syndrome Benign:2

Dec 03, 2020

Sema4, Sema4

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: curation

- -

Nov 16, 2018

Ambry Genetics

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -

not specified Benign:1

Nov 28, 2016

GeneDx

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at a poorly conserved position in the protein, it is predicted to be benign by multiple in silico algorithms, and/or has population frequency not consistent with disease. -

Haddad syndrome Benign:1

Feb 03, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

PHOX2B-related disorder Benign:1

Aug 26, 2024

PreventionGenetics, part of Exact Sciences

Significance: Benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs17879189; hg19: chr4-41747992;