chr4-41745978-C-CGCCGCTGCCGCTGCCGCCGCCGCCGCT

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 2P and 1B. PP5_ModerateBP3

The NM_003924.4(PHOX2B):​c.747_773dupAGCGGCGGCGGCGGCAGCGGCAGCGGC​(p.Ala250_Ala258dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. A258A) has been classified as Likely benign.

Frequency

Genomes: not found (cov: 32)

Consequence

PHOX2B
NM_003924.4 disruptive_inframe_insertion

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 0.931

Publications

0 publications found
Variant links:
Genes affected
PHOX2B (HGNC:9143): (paired like homeobox 2B) The DNA-associated protein encoded by this gene is a member of the paired family of homeobox proteins localized to the nucleus. The protein functions as a transcription factor involved in the development of several major noradrenergic neuron populations and the determination of neurotransmitter phenotype. The gene product is linked to enhancement of second messenger-mediated activation of the dopamine beta-hydroylase, c-fos promoters and several enhancers, including cyclic amp-response element and serum-response element. Expansion of a 20 amino acid polyalanine tract in this protein by 5-13 aa has been associated with congenital central hypoventilation syndrome. [provided by RefSeq, Jul 2016]
PHOX2B Gene-Disease associations (from GenCC):
  • central hypoventilation syndrome, congenital, 1, with or without Hirschsprung disease
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen, G2P
  • Haddad syndrome
    Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
  • neuroblastoma, susceptibility to, 2
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P
  • congenital central hypoventilation syndrome
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

PP5
Variant 4-41745978-C-CGCCGCTGCCGCTGCCGCCGCCGCCGCT is Pathogenic according to our data. Variant chr4-41745978-C-CGCCGCTGCCGCTGCCGCCGCCGCCGCT is described in ClinVar as Pathogenic. ClinVar VariationId is 2625352.Status of the report is criteria_provided_single_submitter, 1 stars.
BP3
Nonframeshift variant in repetitive region in NM_003924.4

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
PHOX2BNM_003924.4 linkc.747_773dupAGCGGCGGCGGCGGCAGCGGCAGCGGC p.Ala250_Ala258dup disruptive_inframe_insertion Exon 3 of 3 ENST00000226382.4 NP_003915.2 Q99453

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
PHOX2BENST00000226382.4 linkc.747_773dupAGCGGCGGCGGCGGCAGCGGCAGCGGC p.Ala250_Ala258dup disruptive_inframe_insertion Exon 3 of 3 1 NM_003924.4 ENSP00000226382.2 Q99453
PHOX2BENST00000510424.2 linkn.*28_*54dupAGCGGCGGCGGCGGCAGCGGCAGCGGC downstream_gene_variant 3

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
Cov.:
31
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Hereditary cancer-predisposing syndrome Pathogenic:1
Sep 06, 2023
Ambry Genetics
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

The p.Ala241[29] pathogenic mutation, located in coding exon 3 of the PHOX2B gene, results from an expansion of the polyalanine repeat region from 20 to 29 repeats. This expansion mutation is associated with congenital central hypoventilation syndrome (Amiel J et al. Nat. Genet., 2003 Apr;33:459-61). Based on the supporting evidence, this alteration is interpreted as a disease-causing mutation. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
0.93

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs778840671; hg19: chr4-41747995; API