chr4-99574882-TGGATGCAGTTGAGGATTGCTGGTCAATATGATTCTTCTTGCTGTGC-T

Variant names:

• chr4-99574882-TGGATGCAGTTGAGGATTGCTGGTCAATATGATTCTTCTTGCTGTGC-T
• NM_001386140.1:c.-27_19delGGATGCAGTTGAGGATTGCTGGTCAATATGATTCTTCTTGCTGTGC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PS1_Moderate PM2

The NM_001386140.1(MTTP):​c.-27_19delGGATGCAGTTGAGGATTGCTGGTCAATATGATTCTTCTTGCTGTGC​(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 32)
• Consequence: MTTP NM_001386140.1 frameshift, start_lost
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 3.13

Genes affected

MTTP (HGNC:7467): (microsomal triglyceride transfer protein) MTP encodes the large subunit of the heterodimeric microsomal triglyceride transfer protein. Protein disulfide isomerase (PDI) completes the heterodimeric microsomal triglyceride transfer protein, which has been shown to play a central role in lipoprotein assembly. Mutations in MTP can cause abetalipoproteinemia. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 30 pathogenic variants in the truncated region.
• PS1: Another start lost variant in NM_001386140.1 (MTTP) was described as [Pathogenic] in Lovd
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MTTP	NM_001386140.1	c.-27_19delGGATGCAGTTGAGGATTGCTGGTCAATATGATTCTTCTTGCTGTGC	p.Met1fs	frameshift_variant, start_lost	Exon 1 of 18	ENST00000265517.10	NP_001373069.1
MTTP	NM_001386140.1	c.-27_19delGGATGCAGTTGAGGATTGCTGGTCAATATGATTCTTCTTGCTGTGC		5_prime_UTR_variant	Exon 1 of 18	ENST00000265517.10	NP_001373069.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MTTP	ENST00000265517.10	c.-27_19delGGATGCAGTTGAGGATTGCTGGTCAATATGATTCTTCTTGCTGTGC	p.Met1fs	frameshift_variant, start_lost	Exon 1 of 18	1	NM_001386140.1	ENSP00000265517.5
MTTP	ENST00000265517	c.-27_19delGGATGCAGTTGAGGATTGCTGGTCAATATGATTCTTCTTGCTGTGC		5_prime_UTR_variant	Exon 1 of 18	1	NM_001386140.1	ENSP00000265517.5

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Dec 10, 2021

Invitae

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change affects the initiator methionine of the MTTP mRNA. The next in-frame methionine is located at codon 84. This variant is not present in population databases (gnomAD no frequency). Disruption of the initiator codon has been observed in individual(s) with abetalipoproteinemia and/or dyslipidemia (PMID: 24842304, 33111339). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr4-100496039;