chr5-1253545-AGGCCTCAGCCGGACACTCAGCCTTCAGCCGGACATGCAGGCCTCGGCCAAACACTCACTCAGGCCTCAGACTCCCAGCGGTGCGGGCCTGGGTGTGGGCCGCCCCTCCCTCCCTGGGACGTAGAGCCCGGCGTGACAGGGCTGCTGGTGTCTGCTCTCGGCCTGGCTGTGGGCGGGT-A
Variant summary
Our verdict is Uncertain significance. The variant received 1 ACMG points: 1P and 0B. PP5
The NM_198253.3(TERT):c.*6_*182del variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).
Frequency
Consequence
NM_198253.3 3_prime_UTR
Scores
Clinical Significance
Conservation
Publications
- pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
- dyskeratosis congenita, autosomal dominant 2Inheritance: AR, AD, SD, Unknown Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Ambry Genetics, G2P, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), ClinGen, Laboratory for Molecular Medicine
- acute myeloid leukemiaInheritance: AD Classification: STRONG, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp
- dyskeratosis congenitaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Hoyeraal-Hreidarsson syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- melanoma, cutaneous malignant, susceptibility to, 9Inheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_198253.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TERT | NM_198253.3 | MANE Select | c.*6_*182del | 3_prime_UTR | Exon 16 of 16 | NP_937983.2 | |||
| TERT | NM_001193376.3 | c.*6_*182del | 3_prime_UTR | Exon 15 of 15 | NP_001180305.1 | ||||
| TERT | NR_149162.3 | n.3113_3289del | non_coding_transcript_exon | Exon 13 of 13 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TERT | ENST00000310581.10 | TSL:1 MANE Select | c.*6_*182del | 3_prime_UTR | Exon 16 of 16 | ENSP00000309572.5 | |||
| TERT | ENST00000922986.1 | c.*6_*182del | 3_prime_UTR | Exon 17 of 17 | ENSP00000593045.1 | ||||
| TERT | ENST00000922985.1 | c.*6_*182del | 3_prime_UTR | Exon 16 of 16 | ENSP00000593044.1 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at