chr5-140114297-GCGGCGGCGGCAGTGGCGGCGGC-G
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1
The NM_005859.5(PURA):c.117_138delCGGCGGCGGCAGTGGCGGCGGC(p.Gly40AlafsTer31) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. G39G) has been classified as Likely benign.
Frequency
Consequence
NM_005859.5 frameshift
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_005859.5. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PURA | TSL:6 MANE Select | c.117_138delCGGCGGCGGCAGTGGCGGCGGC | p.Gly40AlafsTer31 | frameshift | Exon 1 of 1 | ENSP00000332706.3 | Q00577 | ||
| PURA | c.117_138delCGGCGGCGGCAGTGGCGGCGGC | p.Gly40AlafsTer31 | frameshift | Exon 2 of 2 | ENSP00000499133.1 | Q00577 | |||
| PURA | TSL:3 | c.117_138delCGGCGGCGGCAGTGGCGGCGGC | p.Gly40AlafsTer31 | frameshift | Exon 2 of 2 | ENSP00000498560.1 | A0A494C0H6 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 genome Cov.: 31
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.