chr5-179616089-ATAACTTACTCTAAGTACAGTAACAAACAGGCTTTACCG-A

Position:

• chr5-179616089-ATAACTTACTCTAAGTACAGTAACAAACAGGCTTTACCG-A

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_001257293.2(HNRNPH1):​c.1299_1300+36delCGGTAAAGCCTGTTTGTTACTGTACTTAGAGTAAGTTA​(p.Tyr433fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: HNRNPH1 NM_001257293.2 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.499

Genes affected

HNRNPH1 (HGNC:5041): (heterogeneous nuclear ribonucleoprotein H1) This gene encodes a member of a subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins that complex with heterogeneous nuclear RNA. These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some may shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has three repeats of quasi-RRM domains that bind to RNA and is very similar to the family member HNRPF. This gene may be associated with hereditary lymphedema type I. Alternatively spliced transcript variants have been described [provided by RefSeq, Mar 2012]

LOC128966623 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
HNRNPH1	NM_001257293.2	c.1299_1300+36delCGGTAAAGCCTGTTTGTTACTGTACTTAGAGTAAGTTA	p.Tyr433fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	12/14	ENST00000393432.9	NP_001244222.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
HNRNPH1	ENST00000393432.9	c.1299_1300+36delCGGTAAAGCCTGTTTGTTACTGTACTTAGAGTAAGTTA	p.Tyr433fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	12/14	1	NM_001257293.2	ENSP00000377082.4

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

GeneDx

Sep 10, 2019

Not observed in large population cohorts (Lek et al., 2016); Canonical splice site variant in a gene for which loss-of-function is not a known mechanism of disease; Has not been previously published as pathogenic or benign to our knowledge; Variants in candidate genes are classified as variants of uncertain significance in accordance with ACMG guidelines (Richards et al., 2015) -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr5-179043090;