chr5-61332326-GGGCGGCGGCGGCGGCGGCGGGGGCAGCAGC-G

Variant names:

• chr5-61332326-GGGCGGCGGCGGCGGCGGCGGGGGCAGCAGC-G
• rs749694145
• NM_020928.2:c.71_100delGCGGGGGCAGCAGCGGCGGCGGCGGCGGCG

Variant summary

Our verdict is Benign. The variant received -16 ACMG points: 0P and 16B. BP6_Very_Strong BS1 BS2

The NM_020928.2(ZSWIM6):​c.71_100delGCGGGGGCAGCAGCGGCGGCGGCGGCGGCG​(p.Gly24_Gly33del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0198 in 1,117,480 control chromosomes in the GnomAD database, including 259 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★★).

• Frequency:
  • Genomes: 𝑓 0.012 (22 hom., cov: 26)
  • Exomes 𝑓: 0.021 (237 hom.)
• Consequence: ZSWIM6 NM_020928.2 disruptive_inframe_deletion
• Clinical Significance: Benign criteria provided, multiple submitters, no conflicts B:3
• Conservation: PhyloP100: 3.15
• Publications: 0 publications found

Genes affected

ZSWIM6 (HGNC:29316): (zinc finger SWIM-type containing 6) The protein encoded by this gene contains a zinc finger SWI2/SNF2 and MuDR (SWIM) domain. Proteins with SWIM domains have been found in a diverse number of species and are predicted to interact with DNA or proteins. Mutations in this gene result in acromelic frontonasal dysostosis. [provided by RefSeq, Apr 2017]

ZSWIM6 Gene-Disease associations (from GenCC):

• acromelic frontonasal dysostosis

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, G2P, Orphanet, Labcorp Genetics (formerly Invitae)
• neurodevelopmental disorder with movement abnormalities, abnormal gait, and autistic features

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)

ENSG00000288936 (HGNC:):

ACMG classification

Our verdict: Benign. The variant received -16 ACMG points.

• BP6: Variant 5-61332326-GGGCGGCGGCGGCGGCGGCGGGGGCAGCAGC-G is Benign according to our data. Variant chr5-61332326-GGGCGGCGGCGGCGGCGGCGGGGGCAGCAGC-G is described in ClinVar as Benign. ClinVar VariationId is 1249694.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population nfe. GnomAd4 allele frequency = 0.0119 (1760/148130) while in subpopulation NFE AF = 0.0196 (1307/66638). AF 95% confidence interval is 0.0187. There are 22 homozygotes in GnomAd4. There are 786 alleles in the male GnomAd4 subpopulation. Median coverage is 26. This position passed quality control check.
• BS2: High AC in GnomAd4 at 1760 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_020928.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ZSWIM6	NM_020928.2	MANE Select	c.71_100delGCGGGGGCAGCAGCGGCGGCGGCGGCGGCG	p.Gly24_Gly33del	disruptive_inframe_deletion	Exon 1 of 14	NP_065979.1	Q9HCJ5

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ZSWIM6	ENST00000252744.6	TSL:5 MANE Select	c.71_100delGCGGGGGCAGCAGCGGCGGCGGCGGCGGCG	p.Gly24_Gly33del	disruptive_inframe_deletion	Exon 1 of 14	ENSP00000252744.5	Q9HCJ5
	ENSG00000288936	ENST00000821437.1		n.-8_22delGCTGCTGCCCCCGCCGCCGCCGCCGCCGCC		non_coding_transcript_exon	Exon 1 of 2
	ENSG00000288936	ENST00000821446.1		n.-18_12delGCTGCTGCCCCCGCCGCCGCCGCCGCCGCC		non_coding_transcript_exon	Exon 1 of 3

Frequencies

GnomAD3 genomes AF: 0.0119 AC: 1762 AN: 148034 Hom.: 22 Cov.: 26

Gnomad AFR AF: 0.00371

Gnomad AMI AF: 0.00991

Gnomad AMR AF: 0.0132

Gnomad ASJ AF: 0.00762

Gnomad EAS AF: 0.000393

Gnomad SAS AF: 0.00125

Gnomad FIN AF: 0.00343

Gnomad MID AF: 0.0160

Gnomad NFE AF: 0.0196

Gnomad OTH AF: 0.0133

GnomAD2 exomes AF: 0.0110 AC: 5 AN: 456 AF XY: 0.0103

Gnomad ASJ exome AF: 0.00

Gnomad FIN exome AF: 0.00459

Gnomad NFE exome AF: 0.0174

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0210 AC: 20360 AN: 969350 Hom.: 237 AF XY: 0.0213 AC XY: 9743 AN XY: 457572

African (AFR) AF: 0.00203 AC: 40 AN: 19712

American (AMR) AF: 0.0108 AC: 54 AN: 5012

Ashkenazi Jewish (ASJ) AF: 0.00940 AC: 95 AN: 10110

East Asian (EAS) AF: 0.0000514 AC: 1 AN: 19448

South Asian (SAS) AF: 0.00281 AC: 52 AN: 18528

European-Finnish (FIN) AF: 0.00695 AC: 96 AN: 13812

Middle Eastern (MID) AF: 0.00637 AC: 17 AN: 2670

European-Non Finnish (NFE) AF: 0.0230 AC: 19432 AN: 843874

Other (OTH) AF: 0.0158 AC: 573 AN: 36184

GnomAD4 genome AF: 0.0119 AC: 1760 AN: 148130 Hom.: 22 Cov.: 26 AF XY: 0.0109 AC XY: 786 AN XY: 72240

African (AFR) AF: 0.00370 AC: 152 AN: 41050

American (AMR) AF: 0.0132 AC: 196 AN: 14866

Ashkenazi Jewish (ASJ) AF: 0.00762 AC: 26 AN: 3412

East Asian (EAS) AF: 0.000394 AC: 2 AN: 5072

South Asian (SAS) AF: 0.00125 AC: 6 AN: 4798

European-Finnish (FIN) AF: 0.00343 AC: 31 AN: 9044

Middle Eastern (MID) AF: 0.0139 AC: 4 AN: 288

European-Non Finnish (NFE) AF: 0.0196 AC: 1307 AN: 66638

Other (OTH) AF: 0.0131 AC: 27 AN: 2054

Alfa AF: 0.00355 Hom.: 0

ClinVar

ClinVar submissions

Significance: Benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	2	not provided (2)
-	-	1	ZSWIM6-related disorder (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.1
Mutation Taster		=193/7	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs749694145; hg19: chr5-60628153; COSMIC: COSV53174444;