chr5-63960680-AGCGTCTTCACTGTCTTCCTCTCTCGGGCCAGGGCCATCTTGCGCTTCGCCTCGGCGTTGC-A

Position:

• chr5-63960680-AGCGTCTTCACTGTCTTCCTCTCTCGGGCCAGGGCCATCTTGCGCTTCGCCTCGGCGTTGC-A

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM2 PM4 PP3

The NM_000524.4(HTR1A):​c.980_1039delGCAACGCCGAGGCGAAGCGCAAGATGGCCCTGGCCCGAGAGAGGAAGACAGTGAAGACGC​(p.Arg327_Thr346del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: HTR1A NM_000524.4 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 10.0

Genes affected

HTR1A (HGNC:5286): (5-hydroxytryptamine receptor 1A) This gene encodes a G protein-coupled receptor for 5-hydroxytryptamine (serotonin), and belongs to the 5-hydroxytryptamine receptor subfamily. Serotonin has been implicated in a number of physiologic processes and pathologic conditions. Inactivation of this gene in mice results in behavior consistent with an increased anxiety and stress response. Mutation in the promoter of this gene has been associated with menstrual cycle-dependent periodic fevers. [provided by RefSeq, Jun 2012]

ENSG00000248285 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 5 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000524.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
HTR1A	NM_000524.4	c.980_1039delGCAACGCCGAGGCGAAGCGCAAGATGGCCCTGGCCCGAGAGAGGAAGACAGTGAAGACGC	p.Arg327_Thr346del	disruptive_inframe_deletion	1/1	ENST00000323865.5	NP_000515.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
HTR1A	ENST00000323865.5	c.980_1039delGCAACGCCGAGGCGAAGCGCAAGATGGCCCTGGCCCGAGAGAGGAAGACAGTGAAGACGC	p.Arg327_Thr346del	disruptive_inframe_deletion	1/1	6	NM_000524.4	ENSP00000316244.4
ENSG00000248285	ENST00000502882.1	n.97-2725_97-2666delGCAACGCCGAGGCGAAGCGCAAGATGGCCCTGGCCCGAGAGAGGAAGACAGTGAAGACGC		intron_variant		2

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Menstrual cycle-dependent periodic fever Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Laboratorio de Genetica e Diagnostico Molecular, Hospital Israelita Albert Einstein

Dec 02, 2022

ACMG classification criteria: PM2 moderated, PM4 -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr5-63256507;