chr5-70941478-AAAGAAGAATACTGCAGCTTCCTT-A
Variant summary
Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_000344.4(SMN1):c.245_267delAGAAGAATACTGCAGCTTCCTTA(p.Lys82ThrfsTer28) variant causes a frameshift change. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Genomes: not found (cov: 0)
Consequence
SMN1
NM_000344.4 frameshift
NM_000344.4 frameshift
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 5.38
Genes affected
SMN1 (HGNC:11117): (survival of motor neuron 1, telomeric) This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. The telomeric and centromeric copies of this gene are nearly identical and encode the same protein. However, mutations in this gene, the telomeric copy, are associated with spinal muscular atrophy; mutations in the centromeric copy do not lead to disease. The centromeric copy may be a modifier of disease caused by mutation in the telomeric copy. The critical sequence difference between the two genes is a single nucleotide in exon 7, which is thought to be an exon splice enhancer. Note that the nine exons of both the telomeric and centromeric copies are designated historically as exon 1, 2a, 2b, and 3-8. It is thought that gene conversion events may involve the two genes, leading to varying copy numbers of each gene. The protein encoded by this gene localizes to both the cytoplasm and the nucleus. Within the nucleus, the protein localizes to subnuclear bodies called gems which are found near coiled bodies containing high concentrations of small ribonucleoproteins (snRNPs). This protein forms heteromeric complexes with proteins such as SIP1 and GEMIN4, and also interacts with several proteins known to be involved in the biogenesis of snRNPs, such as hnRNP U protein and the small nucleolar RNA binding protein. Multiple transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2014]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 10 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 5-70941478-AAAGAAGAATACTGCAGCTTCCTT-A is Pathogenic according to our data. Variant chr5-70941478-AAAGAAGAATACTGCAGCTTCCTT-A is described in ClinVar as [Pathogenic]. Clinvar id is 3239629.Status of the report is criteria_provided_single_submitter, 1 stars.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 0
GnomAD3 genomes
Cov.:
0
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 0
GnomAD4 genome
Cov.:
0
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Werdnig-Hoffmann disease Pathogenic:1
Jun 04, 2024
DNA-diagnostics Laboratory, Research Centre For Medical Genetics
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing
The Lys82Thrfs*28 variant in the SMN1 gene fulfils the ACMG criteria: PM2, PVS1, PM3, PP4 -
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
Publications
No publications associated with this variant yet.