chr5-71587428-GTGGGCCGTCCTGAGGTTAGCCCTGCGGCCGTGTGCCCGCGCCTCTCCCGCCGGGCCGCGCGCCTA-G

Variant names:

• chr5-71587428-GTGGGCCGTCCTGAGGTTAGCCCTGCGGCCGTGTGCCCGCGCCTCTCCCGCCGGGCCGCGCGCCTA-G
• NM_022132.5:c.5_69delGGGCCGTCCTGAGGTTAGCCCTGCGGCCGTGTGCCCGCGCCTCTCCCGCCGGGCCGCGCGCCTAT

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_022132.5(MCCC2):​c.5_69delGGGCCGTCCTGAGGTTAGCCCTGCGGCCGTGTGCCCGCGCCTCTCCCGCCGGGCCGCGCGCCTAT​(p.Trp2SerfsTer35) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: MCCC2 NM_022132.5 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 2.93

Genes affected

MCCC2 (HGNC:6937): (methylcrotonyl-CoA carboxylase subunit 2) This gene encodes the small subunit of 3-methylcrotonyl-CoA carboxylase. This enzyme functions as a heterodimer and catalyzes the carboxylation of 3-methylcrotonyl-CoA to form 3-methylglutaconyl-CoA. Mutations in this gene are associated with 3-Methylcrotonylglycinuria, an autosomal recessive disorder of leucine catabolism. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2018]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 34 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 5-71587428-GTGGGCCGTCCTGAGGTTAGCCCTGCGGCCGTGTGCCCGCGCCTCTCCCGCCGGGCCGCGCGCCTA-G is Pathogenic according to our data. Variant chr5-71587428-GTGGGCCGTCCTGAGGTTAGCCCTGCGGCCGTGTGCCCGCGCCTCTCCCGCCGGGCCGCGCGCCTA-G is described in ClinVar as [Pathogenic]. Clinvar id is 2871586.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MCCC2	NM_022132.5	c.5_69delGGGCCGTCCTGAGGTTAGCCCTGCGGCCGTGTGCCCGCGCCTCTCCCGCCGGGCCGCGCGCCTAT	p.Trp2SerfsTer35	frameshift_variant	Exon 1 of 17	ENST00000340941.11	NP_071415.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MCCC2	ENST00000340941.11	c.5_69delGGGCCGTCCTGAGGTTAGCCCTGCGGCCGTGTGCCCGCGCCTCTCCCGCCGGGCCGCGCGCCTAT	p.Trp2SerfsTer35	frameshift_variant	Exon 1 of 17	1	NM_022132.5	ENSP00000343657.6

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

3-methylcrotonyl-CoA carboxylase 2 deficiency Pathogenic:1

Aug 23, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals affected with MCCC2-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Trp2Serfs*35) in the MCCC2 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in MCCC2 are known to be pathogenic (PMID: 11181649, 22642865). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr5-70883255;