chr5-80654693-A-AGGCCCTGCCGCCGGGCTGCCATCCT

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 2P and 2B. PM2BP6_Moderate

The NM_002439.5(MSH3):​c.-34_-10dupGGCCCTGCCGCCGGGCTGCCATCCT variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Benign (★).

Frequency

Genomes: not found (cov: 32)

Consequence

MSH3
NM_002439.5 5_prime_UTR

Scores

Not classified

Clinical Significance

Benign criteria provided, single submitter B:1

Conservation

PhyloP100: -0.421
Variant links:
Genes affected
MSH3 (HGNC:7326): (mutS homolog 3) The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. [provided by RefSeq, Mar 2011]
DHFR (HGNC:2861): (dihydrofolate reductase) Dihydrofolate reductase converts dihydrofolate into tetrahydrofolate, a methyl group shuttle required for the de novo synthesis of purines, thymidylic acid, and certain amino acids. While the functional dihydrofolate reductase gene has been mapped to chromosome 5, multiple intronless processed pseudogenes or dihydrofolate reductase-like genes have been identified on separate chromosomes. Dihydrofolate reductase deficiency has been linked to megaloblastic anemia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2014]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 0 ACMG points.

PM2
Very rare variant in population databases, with high coverage;
BP6
Variant 5-80654693-A-AGGCCCTGCCGCCGGGCTGCCATCCT is Benign according to our data. Variant chr5-80654693-A-AGGCCCTGCCGCCGGGCTGCCATCCT is described in ClinVar as [Benign]. Clinvar id is 2673975.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
MSH3NM_002439.5 linkc.-34_-10dupGGCCCTGCCGCCGGGCTGCCATCCT 5_prime_UTR_variant Exon 1 of 24 ENST00000265081.7 NP_002430.3 P20585
DHFRNM_000791.4 linkc.-229_-205dupAGGATGGCAGCCCGGCGGCAGGGCC 5_prime_UTR_variant Exon 1 of 6 ENST00000439211.7 NP_000782.1 P00374-1B0YJ76

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
MSH3ENST00000265081 linkc.-34_-10dupGGCCCTGCCGCCGGGCTGCCATCCT 5_prime_UTR_variant Exon 1 of 24 1 NM_002439.5 ENSP00000265081.6 P20585
DHFRENST00000439211.7 linkc.-229_-205dupAGGATGGCAGCCCGGCGGCAGGGCC 5_prime_UTR_variant Exon 1 of 6 1 NM_000791.4 ENSP00000396308.2 P00374-1
MSH3ENST00000667069 linkc.-34_-10dupGGCCCTGCCGCCGGGCTGCCATCCT 5_prime_UTR_variant Exon 1 of 22 ENSP00000499502.1 A0A590UJN8
MSH3ENST00000670357.1 linkn.-34_-10dupGGCCCTGCCGCCGGGCTGCCATCCT non_coding_transcript_exon_variant Exon 1 of 25 ENSP00000499791.1 A0A590UKC9
MSH3ENST00000670357.1 linkn.-34_-10dupGGCCCTGCCGCCGGGCTGCCATCCT 5_prime_UTR_variant Exon 1 of 25 ENSP00000499791.1 A0A590UKC9

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
Cov.:
32
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Benign
Submissions summary: Benign:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Familial adenomatous polyposis 4 Benign:1
Nov 06, 2023
Myriad Genetics, Inc.
Significance: Benign
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This variant is considered benign. This variant is intronic and is not expected to impact mRNA splicing. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr5-79950512; API