chr6-152208032-ACTCATGGGGAGGTAGGACACTTCAACCAACCATTTACGAAGCTTTTCTGCCATCT-A
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_182961.4(SYNE1):c.22709_22763delAGATGGCAGAAAAGCTTCGTAAATGGTTGGTTGAAGTGTCCTACCTCCCCATGAG(p.Glu7570ValfsTer36) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000137 in 1,461,876 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_182961.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- autosomal recessive ataxia, Beauce typeInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, G2P, Orphanet, Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae)
- arthrogryposis multiplex congenita 3, myogenic typeInheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- Emery-Dreifuss muscular dystrophy 4, autosomal dominantInheritance: AD Classification: MODERATE, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Illumina
- autosomal dominant Emery-Dreifuss muscular dystrophyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- autosomal recessive myogenic arthrogryposis multiplex congenitaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_182961.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SYNE1 | NM_182961.4 | MANE Select | c.22709_22763delAGATGGCAGAAAAGCTTCGTAAATGGTTGGTTGAAGTGTCCTACCTCCCCATGAG | p.Glu7570ValfsTer36 | frameshift | Exon 125 of 146 | NP_892006.3 | ||
| SYNE1 | NM_033071.5 | c.22496_22550delAGATGGCAGAAAAGCTTCGTAAATGGTTGGTTGAAGTGTCCTACCTCCCCATGAG | p.Glu7499ValfsTer36 | frameshift | Exon 124 of 146 | NP_149062.2 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SYNE1 | ENST00000367255.10 | TSL:1 MANE Select | c.22709_22763delAGATGGCAGAAAAGCTTCGTAAATGGTTGGTTGAAGTGTCCTACCTCCCCATGAG | p.Glu7570ValfsTer36 | frameshift | Exon 125 of 146 | ENSP00000356224.5 | ||
| SYNE1 | ENST00000423061.6 | TSL:1 | c.22496_22550delAGATGGCAGAAAAGCTTCGTAAATGGTTGGTTGAAGTGTCCTACCTCCCCATGAG | p.Glu7499ValfsTer36 | frameshift | Exon 124 of 146 | ENSP00000396024.1 | ||
| SYNE1 | ENST00000367251.7 | TSL:1 | c.1475_1529delAGATGGCAGAAAAGCTTCGTAAATGGTTGGTTGAAGTGTCCTACCTCCCCATGAG | p.Glu492ValfsTer36 | frameshift | Exon 10 of 31 | ENSP00000356220.3 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome AF: 0.00000137 AC: 2AN: 1461876Hom.: 0 AF XY: 0.00000138 AC XY: 1AN XY: 727240 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
not provided Pathogenic:3
A variant that is likely pathogenic has been identified in the SYNE1 gene. The c.22496_22550del55 variant in the SYNE1 gene causes a frameshift starting with codon Glutamic acid 7499, changes this amino acid to a Valine residue and creates a premature Stop codon at position 36 of the new reading frame, denoted p.Glu7499ValfsX36. This pathogenic variant is predicted to cause loss of normal protein function either through protein truncation or nonsense-mediated mRNA decay. Therefore, this variant is likely pathogenic; however, the possibility that it is benign cannot be excluded.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at