rs1554558620

Variant names:

• chr6-152208032-ACTCATGGGGAGGTAGGACACTTCAACCAACCATTTACGAAGCTTTTCTGCCATCT-A
• rs1554558620
• NM_182961.4:c.22709_22763delAGATGGCAGAAAAGCTTCGTAAATGGTTGGTTGAAGTGTCCTACCTCCCCATGAG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_182961.4(SYNE1):​c.22709_22763delAGATGGCAGAAAAGCTTCGTAAATGGTTGGTTGAAGTGTCCTACCTCCCCATGAG​(p.Glu7570ValfsTer36) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000137 in 1,461,876 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000014 (0 hom.)
• Consequence: SYNE1 NM_182961.4 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 9.96
• Publications: 0 publications found

Genes affected

SYNE1 (HGNC:17089): (spectrin repeat containing nuclear envelope protein 1) This gene encodes a spectrin repeat containing protein expressed in skeletal and smooth muscle, and peripheral blood lymphocytes, that localizes to the nuclear membrane. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia 8, also referred to as autosomal recessive cerebellar ataxia type 1 or recessive ataxia of Beauce. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

SYNE1 Gene-Disease associations (from GenCC):

• autosomal recessive ataxia, Beauce type

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, G2P, Orphanet, Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae)
• arthrogryposis multiplex congenita 3, myogenic type

  Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• Emery-Dreifuss muscular dystrophy 4, autosomal dominant

  Inheritance: AD Classification: MODERATE, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Illumina
• autosomal dominant Emery-Dreifuss muscular dystrophy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• autosomal recessive myogenic arthrogryposis multiplex congenita

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 6-152208032-ACTCATGGGGAGGTAGGACACTTCAACCAACCATTTACGAAGCTTTTCTGCCATCT-A is Pathogenic according to our data. Variant chr6-152208032-ACTCATGGGGAGGTAGGACACTTCAACCAACCATTTACGAAGCTTTTCTGCCATCT-A is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 448583.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SYNE1	NM_182961.4	c.22709_22763delAGATGGCAGAAAAGCTTCGTAAATGGTTGGTTGAAGTGTCCTACCTCCCCATGAG	p.Glu7570ValfsTer36	frameshift_variant	Exon 125 of 146	ENST00000367255.10	NP_892006.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SYNE1	ENST00000367255.10	c.22709_22763delAGATGGCAGAAAAGCTTCGTAAATGGTTGGTTGAAGTGTCCTACCTCCCCATGAG	p.Glu7570ValfsTer36	frameshift_variant	Exon 125 of 146	1	NM_182961.4	ENSP00000356224.5

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 0.00000137 AC: 2 AN: 1461876 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 727240

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33480

American (AMR) AF: 0.00 AC: 0 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39694

South Asian (SAS) AF: 0.00 AC: 0 AN: 86258

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53420

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00000180 AC: 2 AN: 1112000

Other (OTH) AF: 0.00 AC: 0 AN: 60396

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Pathogenic:3

May 16, 2018

GeneDx

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

A variant that is likely pathogenic has been identified in the SYNE1 gene. The c.22496_22550del55 variant in the SYNE1 gene causes a frameshift starting with codon Glutamic acid 7499, changes this amino acid to a Valine residue and creates a premature Stop codon at position 36 of the new reading frame, denoted p.Glu7499ValfsX36. This pathogenic variant is predicted to cause loss of normal protein function either through protein truncation or nonsense-mediated mRNA decay. Therefore, this variant is likely pathogenic; however, the possibility that it is benign cannot be excluded. -

Jul 17, 2017

Athena Diagnostics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Dec 28, 2016

Eurofins Ntd Llc (ga)

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		10
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554558620; hg19: chr6-152529167;