chr6-156778204-ACCACCACCACCATGCCCACCACCT-A
Variant summary
Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3
The NM_001374828.1(ARID1B):c.537_560delTGCCCACCACCTCCACCACCACCA(p.Ala180_His187del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000661 in 151,232 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. H179H) has been classified as Likely benign.
Frequency
Consequence
NM_001374828.1 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- Coffin-Siris syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, Illumina, ClinGen
- Coffin-Siris syndrome 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -1 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| ARID1B | NM_001374828.1 | c.537_560delTGCCCACCACCTCCACCACCACCA | p.Ala180_His187del | disruptive_inframe_deletion | Exon 1 of 20 | ENST00000636930.2 | NP_001361757.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| ARID1B | ENST00000636930.2 | c.537_560delTGCCCACCACCTCCACCACCACCA | p.Ala180_His187del | disruptive_inframe_deletion | Exon 1 of 20 | 2 | NM_001374828.1 | ENSP00000490491.2 |
Frequencies
GnomAD3 genomes AF: 0.00000661 AC: 1AN: 151232Hom.: 0 Cov.: 31 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AC0 AF: 0.00 AC: 0AN: 1387464Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 684710
GnomAD4 genome AF: 0.00000661 AC: 1AN: 151232Hom.: 0 Cov.: 31 AF XY: 0.0000135 AC XY: 1AN XY: 73858 show subpopulations ⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.
ClinVar
Submissions by phenotype
not specified Uncertain:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at