rs1554247278

Variant names:

• chr6-156778204-ACCACCACCACCATGCCCACCACCT-A
• rs1554247278
• NM_001374828.1:c.537_560delTGCCCACCACCTCCACCACCACCA

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_001374828.1(ARID1B):​c.537_560delTGCCCACCACCTCCACCACCACCA​(p.Ala180_His187del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000661 in 151,232 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. H179H) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 31)
  • Exomes 𝑓: 0.0 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: ARID1B NM_001374828.1 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 3.54
• Publications: 0 publications found

Genes affected

ARID1B (HGNC:18040): (AT-rich interaction domain 1B) This locus encodes an AT-rich DNA interacting domain-containing protein. The encoded protein is a component of the SWI/SNF chromatin remodeling complex and may play a role in cell-cycle activation. The protein encoded by this locus is similar to AT-rich interactive domain-containing protein 1A. These two proteins function as alternative, mutually exclusive ARID-subunits of the SWI/SNF complex. The associated complexes play opposing roles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]

ARID1B Gene-Disease associations (from GenCC):

• Coffin-Siris syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, Illumina, ClinGen
• Coffin-Siris syndrome 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics

ENSG00000271551 (HGNC:):

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001374828.1

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001374828.1. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ARID1B	NM_001374828.1	MANE Select	c.537_560delTGCCCACCACCTCCACCACCACCA	p.Ala180_His187del	disruptive_inframe_deletion	Exon 1 of 20	NP_001361757.1
	ARID1B	NM_001438482.1		c.537_560delTGCCCACCACCTCCACCACCACCA	p.Ala180_His187del	disruptive_inframe_deletion	Exon 1 of 21	NP_001425411.1
	ARID1B	NM_001438483.1		c.537_560delTGCCCACCACCTCCACCACCACCA	p.Ala180_His187del	disruptive_inframe_deletion	Exon 1 of 21	NP_001425412.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ARID1B	ENST00000636930.2	TSL:2 MANE Select	c.537_560delTGCCCACCACCTCCACCACCACCA	p.Ala180_His187del	disruptive_inframe_deletion	Exon 1 of 20	ENSP00000490491.2
	ARID1B	ENST00000346085.10	TSL:1	c.537_560delTGCCCACCACCTCCACCACCACCA	p.Ala180_His187del	disruptive_inframe_deletion	Exon 2 of 21	ENSP00000344546.5
	ARID1B	ENST00000350026.11	TSL:1	c.537_560delTGCCCACCACCTCCACCACCACCA	p.Ala180_His187del	disruptive_inframe_deletion	Exon 1 of 19	ENSP00000055163.8

Frequencies

GnomAD3 genomes AF: 0.00000661 AC: 1 AN: 151232 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000148

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AC0 AF: 0.00 AC: 0 AN: 1387464 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 684710

African (AFR) AF: 0.00 AC: 0 AN: 31496

American (AMR) AF: 0.00 AC: 0 AN: 35694

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25162

East Asian (EAS) AF: 0.00 AC: 0 AN: 35704

South Asian (SAS) AF: 0.00 AC: 0 AN: 79166

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 39446

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4950

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1078054

Other (OTH) AF: 0.00 AC: 0 AN: 57792

GnomAD4 genome AF: 0.00000661 AC: 1 AN: 151232 Hom.: 0 Cov.: 31 AF XY: 0.0000135 AC XY: 1 AN XY: 73858

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 41192

American (AMR) AF: 0.00 AC: 0 AN: 15204

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3458

East Asian (EAS) AF: 0.00 AC: 0 AN: 5088

South Asian (SAS) AF: 0.00 AC: 0 AN: 4764

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10508

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 314

European-Non Finnish (NFE) AF: 0.0000148 AC: 1 AN: 67720

Other (OTH) AF: 0.00 AC: 0 AN: 2074

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

Alfa AF: 0.00 Hom.: 0

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not specified Uncertain:1

Sep 23, 2015

Genetic Services Laboratory, University of Chicago

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.5
Mutation Taster		=149/51	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554247278; hg19: chr6-157099338;