rs1554247278

Positions:

• chr6-156778204-ACCACCACCACCATGCCCACCACCT-A

Variant summary

Our verdict is Uncertain significance. Variant got 1 ACMG points: 2P and 1B. PM2 BP3

The NM_001374828.1(ARID1B):​c.537_560delTGCCCACCACCTCCACCACCACCA​(p.Ala180_His187del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000661 in 151,232 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 31)
  • Exomes 𝑓: 0.0 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: ARID1B NM_001374828.1 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 3.54

Genes affected

ARID1B (HGNC:18040): (AT-rich interaction domain 1B) This locus encodes an AT-rich DNA interacting domain-containing protein. The encoded protein is a component of the SWI/SNF chromatin remodeling complex and may play a role in cell-cycle activation. The protein encoded by this locus is similar to AT-rich interactive domain-containing protein 1A. These two proteins function as alternative, mutually exclusive ARID-subunits of the SWI/SNF complex. The associated complexes play opposing roles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]

ENSG00000271551 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 1 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• BP3: Nonframeshift variant in repetitive region in NM_001374828.1

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ARID1B	NM_001374828.1	c.537_560delTGCCCACCACCTCCACCACCACCA	p.Ala180_His187del	disruptive_inframe_deletion	1/20	ENST00000636930.2	NP_001361757.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ARID1B	ENST00000636930.2	c.537_560delTGCCCACCACCTCCACCACCACCA	p.Ala180_His187del	disruptive_inframe_deletion	1/20	2	NM_001374828.1	ENSP00000490491.2

Frequencies

GnomAD3 genomes AF: 0.00000661 AC: 1 AN: 151232 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000148

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AC0 AF: 0.00 AC: 0 AN: 1387464 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 684710

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.00000661 AC: 1 AN: 151232 Hom.: 0 Cov.: 31 AF XY: 0.0000135 AC XY: 1 AN XY: 73858

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000148

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not specified Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Genetic Services Laboratory, University of Chicago

Sep 23, 2015

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554247278; hg19: chr6-157099338;