chr6-33438437-GCCATGTCTGAGGTAGACCGGT-G
Variant summary
Our verdict is Likely pathogenic. Variant got 7 ACMG points: 7P and 0B. PM1PM2PM4PP3
The NM_006772.3(SYNGAP1):c.1406_1426delCCATGTCTGAGGTAGACCGGT(p.Ala469_Phe476delinsVal) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. A469A) has been classified as Likely benign.
Frequency
Consequence
NM_006772.3 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_pathogenic. Variant got 7 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
SYNGAP1 | NM_006772.3 | c.1406_1426delCCATGTCTGAGGTAGACCGGT | p.Ala469_Phe476delinsVal | disruptive_inframe_deletion | Exon 9 of 19 | ENST00000646630.1 | NP_006763.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
SYNGAP1 | ENST00000646630.1 | c.1406_1426delCCATGTCTGAGGTAGACCGGT | p.Ala469_Phe476delinsVal | disruptive_inframe_deletion | Exon 9 of 19 | NM_006772.3 | ENSP00000496007.1 | |||
SYNGAP1 | ENST00000644458.1 | c.1406_1426delCCATGTCTGAGGTAGACCGGT | p.Ala469_Phe476delinsVal | disruptive_inframe_deletion | Exon 9 of 19 | ENSP00000495541.1 | ||||
SYNGAP1 | ENST00000449372.7 | c.1406_1426delCCATGTCTGAGGTAGACCGGT | p.Ala469_Phe476delinsVal | disruptive_inframe_deletion | Exon 9 of 18 | 5 | ENSP00000416519.4 | |||
SYNGAP1 | ENST00000418600.7 | c.1406_1426delCCATGTCTGAGGTAGACCGGT | p.Ala469_Phe476delinsVal | disruptive_inframe_deletion | Exon 9 of 19 | 5 | ENSP00000403636.3 | |||
SYNGAP1 | ENST00000645250.1 | c.1229_1249delCCATGTCTGAGGTAGACCGGT | p.Ala410_Phe417delinsVal | disruptive_inframe_deletion | Exon 7 of 17 | ENSP00000494861.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Intellectual disability, autosomal dominant 5 Uncertain:1
In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant has not been reported in the literature in individuals with SYNGAP1-related conditions. This variant is not present in population databases (ExAC no frequency). This variant, c.1406_1426del, is a complex sequence change that results in the deletion of 8 and insertion of 1 amino acid(s) in the SYNGAP1 protein (p.Ala469_Phe476delinsVal). -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at