chr6-33438437-GCCATGTCTGAGGTAGACCGGT-G

Position:

• chr6-33438437-GCCATGTCTGAGGTAGACCGGT-G

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM2 PM4 PP3

The NM_006772.3(SYNGAP1):​c.1406_1426delCCATGTCTGAGGTAGACCGGT​(p.Ala469_Phe476delinsVal) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: SYNGAP1 NM_006772.3 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 10.0

Genes affected

SYNGAP1 (HGNC:11497): (synaptic Ras GTPase activating protein 1) This gene encodes a Ras GTPase activating protein that is a member of the N-methyl-D-aspartate receptor complex. The N-terminal domain of the protein contains a Ras-GAP domain, a pleckstrin homology domain, and a C2 domain that may be involved in binding of calcium and phospholipids. The C-terminal domain consists of a ten histidine repeat region, serine and tyrosine phosphorylation sites, and a T/SXV motif required for postsynaptic scaffold protein interaction. The encoded protein negatively regulates Ras, Rap and alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor trafficking to the postsynaptic membrane to regulate synaptic plasticity and neuronal homeostasis. Allelic variants of this gene are associated with intellectual disability and autism spectrum disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]

SYNGAP1 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 5 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_006772.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
SYNGAP1	NM_006772.3	c.1406_1426delCCATGTCTGAGGTAGACCGGT	p.Ala469_Phe476delinsVal	disruptive_inframe_deletion	9/19	ENST00000646630.1	NP_006763.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
SYNGAP1	ENST00000646630.1	c.1406_1426delCCATGTCTGAGGTAGACCGGT	p.Ala469_Phe476delinsVal	disruptive_inframe_deletion	9/19		NM_006772.3	ENSP00000496007.1
SYNGAP1	ENST00000644458.1	c.1406_1426delCCATGTCTGAGGTAGACCGGT	p.Ala469_Phe476delinsVal	disruptive_inframe_deletion	9/19			ENSP00000495541.1
SYNGAP1	ENST00000449372.7	c.1406_1426delCCATGTCTGAGGTAGACCGGT	p.Ala469_Phe476delinsVal	disruptive_inframe_deletion	9/18	5		ENSP00000416519.4
SYNGAP1	ENST00000418600.7	c.1406_1426delCCATGTCTGAGGTAGACCGGT	p.Ala469_Phe476delinsVal	disruptive_inframe_deletion	9/19	5		ENSP00000403636.3
SYNGAP1	ENST00000645250.1	c.1229_1249delCCATGTCTGAGGTAGACCGGT	p.Ala410_Phe417delinsVal	disruptive_inframe_deletion	7/17			ENSP00000494861.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Intellectual disability, autosomal dominant 5 Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Dec 04, 2019

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant has not been reported in the literature in individuals with SYNGAP1-related conditions. This variant is not present in population databases (ExAC no frequency). This variant, c.1406_1426del, is a complex sequence change that results in the deletion of 8 and insertion of 1 amino acid(s) in the SYNGAP1 protein (p.Ala469_Phe476delinsVal). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1760914733; hg19: chr6-33406214;