chr6-33438437-GCCATGTCTGAGGTAGACCGGT-G
Position:
Variant summary
Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM2PM4PP3
The NM_006772.3(SYNGAP1):c.1406_1426delCCATGTCTGAGGTAGACCGGT(p.Ala469_Phe476delinsVal) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Genomes: not found (cov: 32)
Consequence
SYNGAP1
NM_006772.3 disruptive_inframe_deletion
NM_006772.3 disruptive_inframe_deletion
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 10.0
Genes affected
SYNGAP1 (HGNC:11497): (synaptic Ras GTPase activating protein 1) This gene encodes a Ras GTPase activating protein that is a member of the N-methyl-D-aspartate receptor complex. The N-terminal domain of the protein contains a Ras-GAP domain, a pleckstrin homology domain, and a C2 domain that may be involved in binding of calcium and phospholipids. The C-terminal domain consists of a ten histidine repeat region, serine and tyrosine phosphorylation sites, and a T/SXV motif required for postsynaptic scaffold protein interaction. The encoded protein negatively regulates Ras, Rap and alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor trafficking to the postsynaptic membrane to regulate synaptic plasticity and neuronal homeostasis. Allelic variants of this gene are associated with intellectual disability and autism spectrum disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Uncertain_significance. Variant got 5 ACMG points.
PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_006772.3.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
SYNGAP1 | NM_006772.3 | c.1406_1426delCCATGTCTGAGGTAGACCGGT | p.Ala469_Phe476delinsVal | disruptive_inframe_deletion | 9/19 | ENST00000646630.1 | NP_006763.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
SYNGAP1 | ENST00000646630.1 | c.1406_1426delCCATGTCTGAGGTAGACCGGT | p.Ala469_Phe476delinsVal | disruptive_inframe_deletion | 9/19 | NM_006772.3 | ENSP00000496007.1 | |||
SYNGAP1 | ENST00000644458.1 | c.1406_1426delCCATGTCTGAGGTAGACCGGT | p.Ala469_Phe476delinsVal | disruptive_inframe_deletion | 9/19 | ENSP00000495541.1 | ||||
SYNGAP1 | ENST00000449372.7 | c.1406_1426delCCATGTCTGAGGTAGACCGGT | p.Ala469_Phe476delinsVal | disruptive_inframe_deletion | 9/18 | 5 | ENSP00000416519.4 | |||
SYNGAP1 | ENST00000418600.7 | c.1406_1426delCCATGTCTGAGGTAGACCGGT | p.Ala469_Phe476delinsVal | disruptive_inframe_deletion | 9/19 | 5 | ENSP00000403636.3 | |||
SYNGAP1 | ENST00000645250.1 | c.1229_1249delCCATGTCTGAGGTAGACCGGT | p.Ala410_Phe417delinsVal | disruptive_inframe_deletion | 7/17 | ENSP00000494861.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Intellectual disability, autosomal dominant 5 Uncertain:1
Uncertain significance, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Dec 04, 2019 | In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant has not been reported in the literature in individuals with SYNGAP1-related conditions. This variant is not present in population databases (ExAC no frequency). This variant, c.1406_1426del, is a complex sequence change that results in the deletion of 8 and insertion of 1 amino acid(s) in the SYNGAP1 protein (p.Ala469_Phe476delinsVal). - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at