rs1760914733

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM2PM4PP3

The NM_006772.3(SYNGAP1):​c.1406_1426delCCATGTCTGAGGTAGACCGGT​(p.Ala469_Phe476delinsVal) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 32)

Consequence

SYNGAP1
NM_006772.3 disruptive_inframe_deletion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 10.0
Variant links:
Genes affected
SYNGAP1 (HGNC:11497): (synaptic Ras GTPase activating protein 1) This gene encodes a Ras GTPase activating protein that is a member of the N-methyl-D-aspartate receptor complex. The N-terminal domain of the protein contains a Ras-GAP domain, a pleckstrin homology domain, and a C2 domain that may be involved in binding of calcium and phospholipids. The C-terminal domain consists of a ten histidine repeat region, serine and tyrosine phosphorylation sites, and a T/SXV motif required for postsynaptic scaffold protein interaction. The encoded protein negatively regulates Ras, Rap and alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor trafficking to the postsynaptic membrane to regulate synaptic plasticity and neuronal homeostasis. Allelic variants of this gene are associated with intellectual disability and autism spectrum disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
SYNGAP1-AS1 (HGNC:53831): (SYNGAP1 antisense RNA 1)
MIR5004 (HGNC:43532): (microRNA 5004) microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 5 ACMG points.

PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_006772.3.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
SYNGAP1NM_006772.3 linkc.1406_1426delCCATGTCTGAGGTAGACCGGT p.Ala469_Phe476delinsVal disruptive_inframe_deletion Exon 9 of 19 ENST00000646630.1 NP_006763.2 Q96PV0-1A0A1U9X8L0

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
SYNGAP1ENST00000646630.1 linkc.1406_1426delCCATGTCTGAGGTAGACCGGT p.Ala469_Phe476delinsVal disruptive_inframe_deletion Exon 9 of 19 NM_006772.3 ENSP00000496007.1 Q96PV0-1
SYNGAP1ENST00000644458.1 linkc.1406_1426delCCATGTCTGAGGTAGACCGGT p.Ala469_Phe476delinsVal disruptive_inframe_deletion Exon 9 of 19 ENSP00000495541.1 A0A2R8Y6T2
SYNGAP1ENST00000449372.7 linkc.1406_1426delCCATGTCTGAGGTAGACCGGT p.Ala469_Phe476delinsVal disruptive_inframe_deletion Exon 9 of 18 5 ENSP00000416519.4 B7ZCA0
SYNGAP1ENST00000418600.7 linkc.1406_1426delCCATGTCTGAGGTAGACCGGT p.Ala469_Phe476delinsVal disruptive_inframe_deletion Exon 9 of 19 5 ENSP00000403636.3 Q96PV0-2
SYNGAP1ENST00000645250.1 linkc.1229_1249delCCATGTCTGAGGTAGACCGGT p.Ala410_Phe417delinsVal disruptive_inframe_deletion Exon 7 of 17 ENSP00000494861.1 A0A2R8YDS2

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Intellectual disability, autosomal dominant 5 Uncertain:1
Dec 04, 2019
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant has not been reported in the literature in individuals with SYNGAP1-related conditions. This variant is not present in population databases (ExAC no frequency). This variant, c.1406_1426del, is a complex sequence change that results in the deletion of 8 and insertion of 1 amino acid(s) in the SYNGAP1 protein (p.Ala469_Phe476delinsVal). -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1760914733; hg19: chr6-33406214; API