chr6-38722935-GGCAGAAGATGGTTTCTCTCCTTCC-G
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_001206927.2(DNAH8):c.137_160delGTTTCTCTCCTTCCGCAGAAGATG(p.Gly46_Asp53del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000105 in 1,612,534 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_001206927.2 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- spermatogenic failure 46Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen
- spermatogenic failure 5Inheritance: AR Classification: MODERATE Submitted by: Franklin by Genoox
- primary ciliary dyskinesiaInheritance: AR Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001206927.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DNAH8 | NM_001206927.2 | MANE Select | c.137_160delGTTTCTCTCCTTCCGCAGAAGATG | p.Gly46_Asp53del | disruptive_inframe_deletion | Exon 2 of 93 | NP_001193856.1 | ||
| DNAH8 | NM_001371.4 | c.-430_-407delGTTTCTCTCCTTCCGCAGAAGATG | 5_prime_UTR | Exon 2 of 92 | NP_001362.2 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DNAH8 | ENST00000327475.11 | TSL:5 MANE Select | c.137_160delGTTTCTCTCCTTCCGCAGAAGATG | p.Gly46_Asp53del | disruptive_inframe_deletion | Exon 2 of 93 | ENSP00000333363.7 | ||
| DNAH8 | ENST00000373278.8 | TSL:1 | c.137_160delGTTTCTCTCCTTCCGCAGAAGATG | p.Gly46_Asp53del | disruptive_inframe_deletion | Exon 2 of 5 | ENSP00000362375.4 | ||
| DNAH8 | ENST00000449981.6 | TSL:5 | c.137_160delGTTTCTCTCCTTCCGCAGAAGATG | p.Gly46_Asp53del | disruptive_inframe_deletion | Exon 1 of 82 | ENSP00000415331.2 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152156Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.00000412 AC: 1AN: 242566 AF XY: 0.00 show subpopulations
GnomAD4 exome AF: 0.0000110 AC: 16AN: 1460378Hom.: 0 AF XY: 0.00000964 AC XY: 7AN XY: 726482 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152156Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0AN XY: 74318 show subpopulations
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at