chr6-45422693-ACAGCAGCAGCAGCAACAGCAG-A

Variant names:

• chr6-45422693-ACAGCAGCAGCAGCAACAGCAG-A
• rs774172072
• NM_001024630.4:c.193_213delCAACAGCAGCAGCAGCAGCAG

Variant summary

Our verdict is Benign. The variant received -10 ACMG points: 0P and 10B. BP3 BP6 BS1 BS2

The NM_001024630.4(RUNX2):​c.193_213delCAACAGCAGCAGCAGCAGCAG​(p.Gln65_Gln71del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0014 in 1,601,344 control chromosomes in the GnomAD database, including 2 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. Q65Q) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.0016 (0 hom., cov: 30)
  • Exomes 𝑓: 0.0014 (2 hom.)
• Consequence: RUNX2 NM_001024630.4 conservative_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:2 B:4
• Conservation: PhyloP100: 3.50
• Publications: 0 publications found

Genes affected

RUNX2 (HGNC:10472): (RUNX family transcription factor 2) This gene is a member of the RUNX family of transcription factors and encodes a nuclear protein with an Runt DNA-binding domain. This protein is essential for osteoblastic differentiation and skeletal morphogenesis and acts as a scaffold for nucleic acids and regulatory factors involved in skeletal gene expression. The protein can bind DNA both as a monomer or, with more affinity, as a subunit of a heterodimeric complex. Two regions of potential trinucleotide repeat expansions are present in the N-terminal region of the encoded protein, and these and other mutations in this gene have been associated with the bone development disorder cleidocranial dysplasia (CCD). Transcript variants that encode different protein isoforms result from the use of alternate promoters as well as alternate splicing. [provided by RefSeq, Jul 2016]

RUNX2 Gene-Disease associations (from GenCC):

• cleidocranial dysplasia 1

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P, PanelApp Australia, Orphanet
• metaphyseal dysplasia-maxillary hypoplasia-brachydacty syndrome

  Inheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics

ACMG classification

Our verdict: Benign. The variant received -10 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001024630.4
• BP6: Variant 6-45422693-ACAGCAGCAGCAGCAACAGCAG-A is Benign according to our data. Variant chr6-45422693-ACAGCAGCAGCAGCAACAGCAG-A is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 196302.
• BS1: Variant frequency is greater than expected in population nfe. GnomAd4 allele frequency = 0.00156 (237/151656) while in subpopulation NFE AF = 0.00255 (173/67814). AF 95% confidence interval is 0.00224. There are 0 homozygotes in GnomAd4. There are 99 alleles in the male GnomAd4 subpopulation. Median coverage is 30. This position passed quality control check.
• BS2: High AC in GnomAd4 at 237 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001024630.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RUNX2	NM_001024630.4	MANE Select	c.193_213delCAACAGCAGCAGCAGCAGCAG	p.Gln65_Gln71del	conservative_inframe_deletion	Exon 3 of 9	NP_001019801.3	Q13950-1
	RUNX2	NM_001369405.1		c.151_171delCAACAGCAGCAGCAGCAGCAG	p.Gln51_Gln57del	conservative_inframe_deletion	Exon 1 of 7	NP_001356334.1	Q13950-2
	RUNX2	NM_001015051.4		c.193_213delCAACAGCAGCAGCAGCAGCAG	p.Gln65_Gln71del	conservative_inframe_deletion	Exon 3 of 8	NP_001015051.3	Q13950-3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RUNX2	ENST00000647337.2	MANE Select	c.193_213delCAACAGCAGCAGCAGCAGCAG	p.Gln65_Gln71del	conservative_inframe_deletion	Exon 3 of 9	ENSP00000495497.1	Q13950-1
	RUNX2	ENST00000359524.7	TSL:1	c.151_171delCAACAGCAGCAGCAGCAGCAG	p.Gln51_Gln57del	conservative_inframe_deletion	Exon 1 of 7	ENSP00000352514.5	Q13950-2
	RUNX2	ENST00000625924.1	TSL:1	c.151_171delCAACAGCAGCAGCAGCAGCAG	p.Gln51_Gln57del	conservative_inframe_deletion	Exon 1 of 6	ENSP00000485863.1	A0A0D9SEN7

Frequencies

GnomAD3 genomes AF: 0.00156 AC: 237 AN: 151552 Hom.: 0 Cov.: 30

Gnomad AFR AF: 0.000993

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000657

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000390

Gnomad SAS AF: 0.000417

Gnomad FIN AF: 0.000665

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00255

Gnomad OTH AF: 0.000961

GnomAD2 exomes AF: 0.00104 AC: 242 AN: 232308 AF XY: 0.00108

Gnomad AFR exome AF: 0.000232

Gnomad AMR exome AF: 0.000684

Gnomad ASJ exome AF: 0.000104

Gnomad EAS exome AF: 0.000664

Gnomad FIN exome AF: 0.000659

Gnomad NFE exome AF: 0.00170

Gnomad OTH exome AF: 0.000361

GnomAD4 exome AF: 0.00139 AC: 2011 AN: 1449688 Hom.: 2 AF XY: 0.00144 AC XY: 1040 AN XY: 720976

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.000552 AC: 18 AN: 32626

American (AMR) AF: 0.000669 AC: 29 AN: 43352

Ashkenazi Jewish (ASJ) AF: 0.000116 AC: 3 AN: 25896

East Asian (EAS) AF: 0.000856 AC: 33 AN: 38540

South Asian (SAS) AF: 0.000403 AC: 34 AN: 84450

European-Finnish (FIN) AF: 0.00150 AC: 78 AN: 52068

Middle Eastern (MID) AF: 0.00105 AC: 6 AN: 5708

European-Non Finnish (NFE) AF: 0.00155 AC: 1711 AN: 1107184

Other (OTH) AF: 0.00165 AC: 99 AN: 59864

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.00156 AC: 237 AN: 151656 Hom.: 0 Cov.: 30 AF XY: 0.00134 AC XY: 99 AN XY: 74122

African (AFR) AF: 0.000990 AC: 41 AN: 41420

American (AMR) AF: 0.000657 AC: 10 AN: 15230

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3464

East Asian (EAS) AF: 0.000391 AC: 2 AN: 5114

South Asian (SAS) AF: 0.000418 AC: 2 AN: 4784

European-Finnish (FIN) AF: 0.000665 AC: 7 AN: 10524

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 290

European-Non Finnish (NFE) AF: 0.00255 AC: 173 AN: 67814

Other (OTH) AF: 0.000951 AC: 2 AN: 2104

Alfa AF: 0.00129 Hom.: 0

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
-	2	3	not provided (5)
-	-	1	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.5
Mutation Taster		=182/18	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs774172072; hg19: chr6-45390430; COSMIC: COSV61844057; COSMIC: COSV61844057;