chr6-7580714-AAGGGTCCAGTATGACCTGCAGAAAGCAAACAGT-A
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_004415.4(DSP):c.4527_4559delGGTCCAGTATGACCTGCAGAAAGCAAACAGTAG(p.Arg1509_Ser1519del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.0000229 in 1,613,976 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).
Frequency
Consequence
NM_004415.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- keratosis palmoplantaris striata 2Inheritance: AD Classification: DEFINITIVE, STRONG, LIMITED Submitted by: Genomics England PanelApp, Ambry Genetics, G2P
- arrhythmogenic cardiomyopathy with wooly hair and keratodermaInheritance: AR, AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Genomics England PanelApp, Ambry Genetics, Labcorp Genetics (formerly Invitae), Orphanet, G2P, ClinGen
- arrhythmogenic right ventricular dysplasia 8Inheritance: AR, AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
- skin fragility-woolly hair-palmoplantar keratoderma syndromeInheritance: AR, AD Classification: DEFINITIVE, STRONG, SUPPORTIVE, LIMITED Submitted by: Genomics England PanelApp, G2P, Ambry Genetics, Orphanet
- cardiomyopathy, dilated, with wooly hair, keratoderma, and tooth agenesisInheritance: AD Classification: STRONG, MODERATE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics
- dilated cardiomyopathyInheritance: AD Classification: STRONG Submitted by: ClinGen
- lethal acantholytic epidermolysis bullosaInheritance: AR Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet
- familial isolated dilated cardiomyopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- striate palmoplantar keratodermaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- severe dermatitis-multiple allergies-metabolic wasting syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- hypertrophic cardiomyopathyInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_004415.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DSP | MANE Select | c.4527_4559delGGTCCAGTATGACCTGCAGAAAGCAAACAGTAG | p.Arg1509_Ser1519del | disruptive_inframe_deletion | Exon 23 of 24 | NP_004406.2 | P15924-1 | ||
| DSP | c.4050+477_4050+509delGGTCCAGTATGACCTGCAGAAAGCAAACAGTAG | intron | N/A | NP_001305963.1 | P15924-3 | ||||
| DSP | c.3582+945_3582+977delGGTCCAGTATGACCTGCAGAAAGCAAACAGTAG | intron | N/A | NP_001008844.1 | P15924-2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DSP | TSL:1 MANE Select | c.4527_4559delGGTCCAGTATGACCTGCAGAAAGCAAACAGTAG | p.Arg1509_Ser1519del | disruptive_inframe_deletion | Exon 23 of 24 | ENSP00000369129.3 | P15924-1 | ||
| DSP | TSL:1 | c.3582+945_3582+977delGGTCCAGTATGACCTGCAGAAAGCAAACAGTAG | intron | N/A | ENSP00000396591.2 | P15924-2 | |||
| DSP | c.4401_4433delGGTCCAGTATGACCTGCAGAAAGCAAACAGTAG | p.Arg1467_Ser1477del | disruptive_inframe_deletion | Exon 23 of 24 | ENSP00000519203.1 | A0AAQ5BH40 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152218Hom.: 0 Cov.: 32 show subpopulations
GnomAD4 exome AF: 0.0000246 AC: 36AN: 1461758Hom.: 0 AF XY: 0.0000261 AC XY: 19AN XY: 727174 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152218Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0AN XY: 74368 show subpopulations
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at