rs397516939
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_004415.4(DSP):c.4527_4559delGGTCCAGTATGACCTGCAGAAAGCAAACAGTAG(p.Arg1509_Ser1519del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.0000229 in 1,613,976 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).
Frequency
Consequence
NM_004415.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- arrhythmogenic right ventricular dysplasia 8Inheritance: AD, AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
- keratosis palmoplantaris striata 2Inheritance: AD Classification: DEFINITIVE, STRONG, LIMITED Submitted by: G2P, Ambry Genetics, Genomics England PanelApp
- skin fragility-woolly hair-palmoplantar keratoderma syndromeInheritance: AD, AR Classification: DEFINITIVE, STRONG, SUPPORTIVE, LIMITED Submitted by: Orphanet, G2P, Genomics England PanelApp, Ambry Genetics
- arrhythmogenic cardiomyopathy with wooly hair and keratodermaInheritance: AR, AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Genomics England PanelApp, ClinGen, Orphanet, Ambry Genetics
- cardiomyopathy, dilated, with wooly hair, keratoderma, and tooth agenesisInheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
- lethal acantholytic epidermolysis bullosaInheritance: AR Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: PanelApp Australia, Ambry Genetics, Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Orphanet
- familial isolated dilated cardiomyopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- striate palmoplantar keratodermaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- severe dermatitis-multiple allergies-metabolic wasting syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- hypertrophic cardiomyopathyInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| DSP | NM_004415.4 | c.4527_4559delGGTCCAGTATGACCTGCAGAAAGCAAACAGTAG | p.Arg1509_Ser1519del | disruptive_inframe_deletion | Exon 23 of 24 | ENST00000379802.8 | NP_004406.2 | |
| DSP | NM_001319034.2 | c.4050+477_4050+509delGGTCCAGTATGACCTGCAGAAAGCAAACAGTAG | intron_variant | Intron 23 of 23 | NP_001305963.1 | |||
| DSP | NM_001008844.3 | c.3582+945_3582+977delGGTCCAGTATGACCTGCAGAAAGCAAACAGTAG | intron_variant | Intron 23 of 23 | NP_001008844.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| DSP | ENST00000379802.8 | c.4527_4559delGGTCCAGTATGACCTGCAGAAAGCAAACAGTAG | p.Arg1509_Ser1519del | disruptive_inframe_deletion | Exon 23 of 24 | 1 | NM_004415.4 | ENSP00000369129.3 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152218Hom.: 0 Cov.: 32 show subpopulations
GnomAD4 exome AF: 0.0000246 AC: 36AN: 1461758Hom.: 0 AF XY: 0.0000261 AC XY: 19AN XY: 727174 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152218Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0AN XY: 74368 show subpopulations
ClinVar
Submissions by phenotype
Cardiomyopathy Uncertain:2
- -
This variant causes an in-frame deletion of eleven amino acids in the central rod domain of the DSP protein that is thought to form a dimeric coiled coil. To our knowledge, functional studies have not been reported for this variant. This variant has not been reported in individuals affected with cardiovascular disorders in the literature. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance. -
not specified Uncertain:1
Variant classified as Uncertain Significance - Favor Pathogenic. The Arg1509_Ser 1519del variant has not been reported in the literature but has been identified by our laboratory in 1 out of >200 Caucasian individuals sequenced to date. T his variant causes an in-frame deletion of 10 amino acids. While this is expect ed to severely impact the protein additional data such as control studies, segre gation data, or functional analysis is needed whether this variant is disease ca using. -
Arrhythmogenic cardiomyopathy with wooly hair and keratoderma Uncertain:1
This variant causes an in-frame deletion of eleven amino acids in the central rod domain of the DSP protein that is thought to form a dimeric coiled coil. To our knowledge, functional studies have not been reported for this variant. This variant has not been reported in individuals affected with cardiovascular disorders in the literature. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance. -
Arrhythmogenic right ventricular dysplasia 8;C1854063:Arrhythmogenic cardiomyopathy with wooly hair and keratoderma Uncertain:1
This variant, c.4527_4559del, results in the deletion of 11 amino acid(s) of the DSP protein (p.Arg1509_Ser1519del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with DSP-related conditions. ClinVar contains an entry for this variant (Variation ID: 44913). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Cardiovascular phenotype Uncertain:1
The c.4527_4559del33 (p.R1509_S1519del) alteration is located in exon 23 (coding exon 23) of the DSP gene. This alteration consists of an in-frame deletion of 33 nucleotides between nucleotide positions c.4527 and c.4559, resulting in the deletion of 11 residues. Based on insufficient or conflicting evidence, the clinical significance of this alteration remains unclear. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at