rs397516939

Variant names:

• chr6-7580714-AAGGGTCCAGTATGACCTGCAGAAAGCAAACAGT-A
• rs397516939
• NM_004415.4:c.4527_4559delGGTCCAGTATGACCTGCAGAAAGCAAACAGTAG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_004415.4(DSP):​c.4527_4559delGGTCCAGTATGACCTGCAGAAAGCAAACAGTAG​(p.Arg1509_Ser1519del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.0000229 in 1,613,976 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000025 (0 hom.)
• Consequence: DSP NM_004415.4 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:6
• Conservation: PhyloP100: 5.49
• Publications: 0 publications found

Genes affected

DSP (HGNC:3052): (desmoplakin) This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]

DSP Gene-Disease associations (from GenCC):

• arrhythmogenic right ventricular dysplasia 8

  Inheritance: AD, AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
• keratosis palmoplantaris striata 2

  Inheritance: AD Classification: DEFINITIVE, STRONG, LIMITED Submitted by: G2P, Ambry Genetics, Genomics England PanelApp
• skin fragility-woolly hair-palmoplantar keratoderma syndrome

  Inheritance: AD, AR Classification: DEFINITIVE, STRONG, SUPPORTIVE, LIMITED Submitted by: Orphanet, G2P, Genomics England PanelApp, Ambry Genetics
• arrhythmogenic cardiomyopathy with wooly hair and keratoderma

  Inheritance: AR, AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Genomics England PanelApp, ClinGen, Orphanet, Ambry Genetics
• cardiomyopathy, dilated, with wooly hair, keratoderma, and tooth agenesis

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
• lethal acantholytic epidermolysis bullosa

  Inheritance: AR Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: PanelApp Australia, Ambry Genetics, Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Orphanet
• familial isolated dilated cardiomyopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• striate palmoplantar keratoderma

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• severe dermatitis-multiple allergies-metabolic wasting syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• hypertrophic cardiomyopathy

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_004415.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
DSP	NM_004415.4	c.4527_4559delGGTCCAGTATGACCTGCAGAAAGCAAACAGTAG	p.Arg1509_Ser1519del	disruptive_inframe_deletion	Exon 23 of 24	ENST00000379802.8	NP_004406.2
DSP	NM_001319034.2	c.4050+477_4050+509delGGTCCAGTATGACCTGCAGAAAGCAAACAGTAG		intron_variant	Intron 23 of 23		NP_001305963.1
DSP	NM_001008844.3	c.3582+945_3582+977delGGTCCAGTATGACCTGCAGAAAGCAAACAGTAG		intron_variant	Intron 23 of 23		NP_001008844.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
DSP	ENST00000379802.8	c.4527_4559delGGTCCAGTATGACCTGCAGAAAGCAAACAGTAG	p.Arg1509_Ser1519del	disruptive_inframe_deletion	Exon 23 of 24	1	NM_004415.4	ENSP00000369129.3

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152218 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000246 AC: 36 AN: 1461758 Hom.: 0 AF XY: 0.0000261 AC XY: 19 AN XY: 727174

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33480

American (AMR) AF: 0.00 AC: 0 AN: 44722

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39696

South Asian (SAS) AF: 0.00 AC: 0 AN: 86256

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53298

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.0000297 AC: 33 AN: 1112006

Other (OTH) AF: 0.0000497 AC: 3 AN: 60396

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152218 Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0 AN XY: 74368

African (AFR) AF: 0.00 AC: 0 AN: 41466

American (AMR) AF: 0.00 AC: 0 AN: 15282

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5196

South Asian (SAS) AF: 0.00 AC: 0 AN: 4830

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10614

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000147 AC: 1 AN: 68040

Other (OTH) AF: 0.00 AC: 0 AN: 2092

Alfa AF: 0.0000712 Hom.: 0

Bravo AF: 0.0000189

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:6

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Cardiomyopathy Uncertain:2

May 30, 2022

CHEO Genetics Diagnostic Laboratory, Children's Hospital of Eastern Ontario

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Oct 04, 2023

Color Diagnostics, LLC DBA Color Health

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant causes an in-frame deletion of eleven amino acids in the central rod domain of the DSP protein that is thought to form a dimeric coiled coil. To our knowledge, functional studies have not been reported for this variant. This variant has not been reported in individuals affected with cardiovascular disorders in the literature. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance. -

not specified Uncertain:1

Aug 22, 2011

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant classified as Uncertain Significance - Favor Pathogenic. The Arg1509_Ser 1519del variant has not been reported in the literature but has been identified by our laboratory in 1 out of >200 Caucasian individuals sequenced to date. T his variant causes an in-frame deletion of 10 amino acids. While this is expect ed to severely impact the protein additional data such as control studies, segre gation data, or functional analysis is needed whether this variant is disease ca using. -

Arrhythmogenic cardiomyopathy with wooly hair and keratoderma Uncertain:1

Feb 05, 2024

All of Us Research Program, National Institutes of Health

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant causes an in-frame deletion of eleven amino acids in the central rod domain of the DSP protein that is thought to form a dimeric coiled coil. To our knowledge, functional studies have not been reported for this variant. This variant has not been reported in individuals affected with cardiovascular disorders in the literature. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance. -

Arrhythmogenic right ventricular dysplasia 8;C1854063:Arrhythmogenic cardiomyopathy with wooly hair and keratoderma Uncertain:1

Oct 07, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.4527_4559del, results in the deletion of 11 amino acid(s) of the DSP protein (p.Arg1509_Ser1519del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with DSP-related conditions. ClinVar contains an entry for this variant (Variation ID: 44913). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Cardiovascular phenotype Uncertain:1

Jul 27, 2021

Ambry Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.4527_4559del33 (p.R1509_S1519del) alteration is located in exon 23 (coding exon 23) of the DSP gene. This alteration consists of an in-frame deletion of 33 nucleotides between nucleotide positions c.4527 and c.4559, resulting in the deletion of 11 residues. Based on insufficient or conflicting evidence, the clinical significance of this alteration remains unclear. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.5
Mutation Taster		=41/159	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs397516939; hg19: chr6-7580947;