chr7-150958438-CGACGACTCCCGGGCCGTCAGCGCCA-C
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_000238.4(KCNH2):c.512_536delTGGCGCTGACGGCCCGGGAGTCGTC(p.Leu171ArgfsTer22) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000238.4 frameshift
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 12 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
KCNH2 | NM_000238.4 | c.512_536delTGGCGCTGACGGCCCGGGAGTCGTC | p.Leu171ArgfsTer22 | frameshift_variant | Exon 4 of 15 | ENST00000262186.10 | NP_000229.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
KCNH2 | ENST00000262186.10 | c.512_536delTGGCGCTGACGGCCCGGGAGTCGTC | p.Leu171ArgfsTer22 | frameshift_variant | Exon 4 of 15 | 1 | NM_000238.4 | ENSP00000262186.5 | ||
KCNH2 | ENST00000532957.5 | n.735_759delTGGCGCTGACGGCCCGGGAGTCGTC | non_coding_transcript_exon_variant | Exon 4 of 9 | 2 | |||||
KCNH2 | ENST00000684241.1 | n.1345_1369delTGGCGCTGACGGCCCGGGAGTCGTC | non_coding_transcript_exon_variant | Exon 2 of 13 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Long QT syndrome Pathogenic:1
Loss-of-function variants in KCNH2 are known to be pathogenic (PMID: 19862833). For these reasons, this variant has been classified as Pathogenic. This sequence change creates a premature translational stop signal (p.Leu171Argfs*22) in the KCNH2 gene. It is expected to result in an absent or disrupted protein product. While this variant is not present in population databases, the frequency information is unreliable, as metrics indicate poor data quality at this position in the ExAC database. This variant has not been reported in the literature in individuals with KCNH2-related disease. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at