rs1554427943

Variant names:

• chr7-150958438-CGACGACTCCCGGGCCGTCAGCGCCA-C
• rs1554427943
• NM_000238.4:c.512_536delTGGCGCTGACGGCCCGGGAGTCGTC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_000238.4(KCNH2):​c.512_536delTGGCGCTGACGGCCCGGGAGTCGTC​(p.Leu171ArgfsTer22) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: KCNH2 NM_000238.4 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 6.41

Genes affected

KCNH2 (HGNC:6251): (potassium voltage-gated channel subfamily H member 2) This gene encodes a component of a voltage-activated potassium channel found in cardiac muscle, nerve cells, and microglia. Four copies of this protein interact with one copy of the KCNE2 protein to form a functional potassium channel. Mutations in this gene can cause long QT syndrome type 2 (LQT2). Transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, May 2022]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 7-150958438-CGACGACTCCCGGGCCGTCAGCGCCA-C is Pathogenic according to our data. Variant chr7-150958438-CGACGACTCCCGGGCCGTCAGCGCCA-C is described in ClinVar as [Pathogenic]. Clinvar id is 526925.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
KCNH2	NM_000238.4	c.512_536delTGGCGCTGACGGCCCGGGAGTCGTC	p.Leu171ArgfsTer22	frameshift_variant	Exon 4 of 15	ENST00000262186.10	NP_000229.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
KCNH2	ENST00000262186.10	c.512_536delTGGCGCTGACGGCCCGGGAGTCGTC	p.Leu171ArgfsTer22	frameshift_variant	Exon 4 of 15	1	NM_000238.4	ENSP00000262186.5
KCNH2	ENST00000532957.5	n.735_759delTGGCGCTGACGGCCCGGGAGTCGTC		non_coding_transcript_exon_variant	Exon 4 of 9	2
KCNH2	ENST00000684241.1	n.1345_1369delTGGCGCTGACGGCCCGGGAGTCGTC		non_coding_transcript_exon_variant	Exon 2 of 13

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Long QT syndrome Pathogenic:1

Sep 25, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Loss-of-function variants in KCNH2 are known to be pathogenic (PMID: 19862833). For these reasons, this variant has been classified as Pathogenic. This sequence change creates a premature translational stop signal (p.Leu171Argfs*22) in the KCNH2 gene. It is expected to result in an absent or disrupted protein product. While this variant is not present in population databases, the frequency information is unreliable, as metrics indicate poor data quality at this position in the ExAC database. This variant has not been reported in the literature in individuals with KCNH2-related disease. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554427943; hg19: chr7-150655526;