rs1554427943

Variant names:

• chr7-150958438-CGACGACTCCCGGGCCGTCAGCGCCA-C
• rs1554427943
• NM_000238.4:c.512_536delTGGCGCTGACGGCCCGGGAGTCGTC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_000238.4(KCNH2):​c.512_536delTGGCGCTGACGGCCCGGGAGTCGTC​(p.Leu171ArgfsTer22) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: KCNH2 NM_000238.4 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 6.41
• Publications: 0 publications found

Genes affected

KCNH2 (HGNC:6251): (potassium voltage-gated channel subfamily H member 2) This gene encodes a component of a voltage-activated potassium channel found in cardiac muscle, nerve cells, and microglia. Four copies of this protein interact with one copy of the KCNE2 protein to form a functional potassium channel. Mutations in this gene can cause long QT syndrome type 2 (LQT2). Transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, May 2022]

KCNH2 Gene-Disease associations (from GenCC):

• long QT syndrome

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• long QT syndrome 2

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
• short QT syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• short QT syndrome type 1

  Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
• Brugada syndrome

  Inheritance: AD Classification: MODERATE, NO_KNOWN Submitted by: ClinGen, Genomics England PanelApp

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 7-150958438-CGACGACTCCCGGGCCGTCAGCGCCA-C is Pathogenic according to our data. Variant chr7-150958438-CGACGACTCCCGGGCCGTCAGCGCCA-C is described in ClinVar as Pathogenic. ClinVar VariationId is 526925.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
KCNH2	NM_000238.4	c.512_536delTGGCGCTGACGGCCCGGGAGTCGTC	p.Leu171ArgfsTer22	frameshift_variant	Exon 4 of 15	ENST00000262186.10	NP_000229.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
KCNH2	ENST00000262186.10	c.512_536delTGGCGCTGACGGCCCGGGAGTCGTC	p.Leu171ArgfsTer22	frameshift_variant	Exon 4 of 15	1	NM_000238.4	ENSP00000262186.5

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Long QT syndrome Pathogenic:1

Sep 25, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Loss-of-function variants in KCNH2 are known to be pathogenic (PMID: 19862833). For these reasons, this variant has been classified as Pathogenic. This sequence change creates a premature translational stop signal (p.Leu171Argfs*22) in the KCNH2 gene. It is expected to result in an absent or disrupted protein product. While this variant is not present in population databases, the frequency information is unreliable, as metrics indicate poor data quality at this position in the ExAC database. This variant has not been reported in the literature in individuals with KCNH2-related disease. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.4
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554427943; hg19: chr7-150655526;