chr7-150974766-CTGCGCGATCTGCGCGGCAGCGCGGCGCTGCG-C

Variant names:

• chr7-150974766-CTGCGCGATCTGCGCGGCAGCGCGGCGCTGCG-C
• rs1554430908
• NM_000238.4:c.221_251delCGCAGCGCCGCGCTGCCGCGCAGATCGCGCA

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000238.4(KCNH2):​c.221_251delCGCAGCGCCGCGCTGCCGCGCAGATCGCGCA​(p.Thr74ArgfsTer32) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. T74T) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 34)
• Consequence: KCNH2 NM_000238.4 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 9.04
• Publications: 0 publications found

Genes affected

KCNH2 (HGNC:6251): (potassium voltage-gated channel subfamily H member 2) This gene encodes a component of a voltage-activated potassium channel found in cardiac muscle, nerve cells, and microglia. Four copies of this protein interact with one copy of the KCNE2 protein to form a functional potassium channel. Mutations in this gene can cause long QT syndrome type 2 (LQT2). Transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, May 2022]

KCNH2 Gene-Disease associations (from GenCC):

• long QT syndrome

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• long QT syndrome 2

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
• short QT syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• short QT syndrome type 1

  Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
• Brugada syndrome

  Inheritance: AD Classification: MODERATE, NO_KNOWN Submitted by: ClinGen, Genomics England PanelApp

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 7-150974766-CTGCGCGATCTGCGCGGCAGCGCGGCGCTGCG-C is Pathogenic according to our data. Variant chr7-150974766-CTGCGCGATCTGCGCGGCAGCGCGGCGCTGCG-C is described in ClinVar as Pathogenic. ClinVar VariationId is 503735.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
KCNH2	NM_000238.4	c.221_251delCGCAGCGCCGCGCTGCCGCGCAGATCGCGCA	p.Thr74ArgfsTer32	frameshift_variant	Exon 2 of 15	ENST00000262186.10	NP_000229.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
KCNH2	ENST00000262186.10	c.221_251delCGCAGCGCCGCGCTGCCGCGCAGATCGCGCA	p.Thr74ArgfsTer32	frameshift_variant	Exon 2 of 15	1	NM_000238.4	ENSP00000262186.5

Frequencies

GnomAD3 genomes Cov.: 34

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 34

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Long QT syndrome Pathogenic:2

Feb 20, 2024

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: KCNH2 c.221_251del31 (p.Thr74ArgfsX32) results in a premature termination codon, predicted to cause absence of the protein due to nonsense mediated decay, which is a commonly known mechanism for disease. The variant was absent in 228884 control chromosomes (gnomAD). c.221_251del31 has been reported in the literature in individuals affected with Long QT Syndrome (e.g. Shimizu_2009). These data indicate that the variant is likely associated with disease. The following publication has been ascertained in the context of this evaluation (PMID: 19926013). ClinVar contains an entry for this variant (Variation ID: 503735). Based on the evidence outlined above, the variant was classified as pathogenic. -

Dec 13, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Thr74Argfs*32) in the KCNH2 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in KCNH2 are known to be pathogenic (PMID: 10973849, 19862833). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with KCNH2-related conditions. ClinVar contains an entry for this variant (Variation ID: 503735). For these reasons, this variant has been classified as Pathogenic. -

not provided Pathogenic:1

Oct 02, 2019

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Reported in ClinVar as a pathogenic variant by another clinical laboratory (ClinVar Variant ID# 503735; Landrum et al., 2016); Not observed in large population cohorts (Lek et al., 2016); Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; This variant is associated with the following publications: (PMID: 10973849, 15840476, 19038855) -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.0
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554430908; hg19: chr7-150671854;