chr7-150974766-CTGCGCGATCTGCGCGGCAGCGCGGCGCTGCG-C

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong

The NM_000238.4(KCNH2):​c.221_251delCGCAGCGCCGCGCTGCCGCGCAGATCGCGCA​(p.Thr74ArgfsTer32) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. T74T) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 34)

Consequence

KCNH2
NM_000238.4 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, multiple submitters, no conflicts P:3

Conservation

PhyloP100: 9.04

Publications

0 publications found
Variant links:
Genes affected
KCNH2 (HGNC:6251): (potassium voltage-gated channel subfamily H member 2) This gene encodes a component of a voltage-activated potassium channel found in cardiac muscle, nerve cells, and microglia. Four copies of this protein interact with one copy of the KCNE2 protein to form a functional potassium channel. Mutations in this gene can cause long QT syndrome type 2 (LQT2). Transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, May 2022]
KCNH2 Gene-Disease associations (from GenCC):
  • long QT syndrome
    Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
  • long QT syndrome 2
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
  • short QT syndrome
    Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
  • short QT syndrome type 1
    Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
  • Brugada syndrome
    Inheritance: AD Classification: MODERATE, NO_KNOWN Submitted by: ClinGen, Genomics England PanelApp

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 16 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 7-150974766-CTGCGCGATCTGCGCGGCAGCGCGGCGCTGCG-C is Pathogenic according to our data. Variant chr7-150974766-CTGCGCGATCTGCGCGGCAGCGCGGCGCTGCG-C is described in ClinVar as Pathogenic. ClinVar VariationId is 503735.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
KCNH2NM_000238.4 linkc.221_251delCGCAGCGCCGCGCTGCCGCGCAGATCGCGCA p.Thr74ArgfsTer32 frameshift_variant Exon 2 of 15 ENST00000262186.10 NP_000229.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
KCNH2ENST00000262186.10 linkc.221_251delCGCAGCGCCGCGCTGCCGCGCAGATCGCGCA p.Thr74ArgfsTer32 frameshift_variant Exon 2 of 15 1 NM_000238.4 ENSP00000262186.5

Frequencies

GnomAD3 genomes
Cov.:
34
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
34

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:3
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Long QT syndrome Pathogenic:2
Feb 20, 2024
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

Variant summary: KCNH2 c.221_251del31 (p.Thr74ArgfsX32) results in a premature termination codon, predicted to cause absence of the protein due to nonsense mediated decay, which is a commonly known mechanism for disease. The variant was absent in 228884 control chromosomes (gnomAD). c.221_251del31 has been reported in the literature in individuals affected with Long QT Syndrome (e.g. Shimizu_2009). These data indicate that the variant is likely associated with disease. The following publication has been ascertained in the context of this evaluation (PMID: 19926013). ClinVar contains an entry for this variant (Variation ID: 503735). Based on the evidence outlined above, the variant was classified as pathogenic. -

Dec 13, 2023
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This sequence change creates a premature translational stop signal (p.Thr74Argfs*32) in the KCNH2 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in KCNH2 are known to be pathogenic (PMID: 10973849, 19862833). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with KCNH2-related conditions. ClinVar contains an entry for this variant (Variation ID: 503735). For these reasons, this variant has been classified as Pathogenic. -

not provided Pathogenic:1
Oct 02, 2019
GeneDx
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

Reported in ClinVar as a pathogenic variant by another clinical laboratory (ClinVar Variant ID# 503735; Landrum et al., 2016); Not observed in large population cohorts (Lek et al., 2016); Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; This variant is associated with the following publications: (PMID: 10973849, 15840476, 19038855) -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.0
Mutation Taster
=1/199
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1554430908; hg19: chr7-150671854; API